similar to: Scripting SVG with R

Dear all, is there a good way to create SVG plots with R whose elements have titles (tooltips) or act as hyperlinks? I am using the RSvgDevice package, which works great - but it doesn't seem to support the notion that plot objects have titles or are act as hyperlinks, so I am helping myself by giving the objects funny unique colors and then postprocessing the .svg file. I wonder

My machine has 8GB memory. I had quit all other programs that might take a lot of memory when I try the script (before I post the first message in this thread). The cdf file is of only 741 MB. It is strange to me to see the error. On Mon, Dec 28, 2009 at 2:38 AM, Wolfgang Huber <whuber at embl.de> wrote: > Dear Peng Yu > > how big is the RAM of your computer? You could try with

Hi, I am finding the recently added [1] functionality of embedding raster images into plots on R devices very useful! Thanks to Paul Murrell and others for providing that. I noted that in https://svn.r-project.org/R/trunk/src/library/grDevices/src/devPS.c a macro is defined: #define MAX_RASTERS 64, and consequently, I get Error in grid.Call.graphics("L_raster", x$raster, x$x, x$y,

Good day, The use of "rounding" also doesn't make sense. If The number is halfway between two integers, it is rounded to the nearest even integer. > round(2.5) [1] 2 -------------------------------------- Dario Strbenac University of Sydney Camperdown NSW 2050 Australia

Hi, when running the following on different instances of R (Linux and Windows), I get different results. The one for Linux seems to be the intended / documented one. When using numeric indices rather than characters, Windows seemed to behave as expected. -----------On Windows-------------- x = matrix(FALSE, nrow=3, ncol=3) colnames(x) = LETTERS[1:3] rownames(x) = letters[1:3] x # A

Hello, I often find myself writing code like : if( require( "foo" ) && compareVersion( packageDescription( "foo")[["Version"]], "2.1" ) < 0 ){ # code that uses version 2.1 of foo } else { stop( "could not load version >= 2.1 of foo" ) } Would it make sense to include something like this in require, library, etc ... require(

Hi all:I found some great demonstrations of interactive presentation graphics generated in R with the SVGAnnotation package, here:http://www.omegahat.org/SVGAnnotation/http://www.omegahat.org/SVGAnnotation/SVGAnnotationPaper/SVGAnnotationPaper.htmlI tried to install the package available at that website (it's not on CRAN) and am getting some pretty uninformative errors (see below). My best

Hi the list, I define a method that want to change an object without assignation (foo(x) and not x<-foo(x)) using deparse and assign. But when the argument of the method does not match *exactly* with the definition of the generic function, assign does not work... Anything wrong? Christophe #------ Does not work ------#

Dear colleagues, I wish to report a problem I encounter when trying to save a graphic to file. When I produce a graphic and try to save it R becomes unresponsive and I must force quit, and then restart R. The problem occurs when I try to overwrite an existing graphic: for example when I made changes to the graphic and want to save the graphic using the original file name. It only happens when I

This was actually the first thing that ChatGPT debugged for me. The issue was that I was able to click on the link when I displayed the raw SVG in the browser (you can use that to test whether the syntax is even correct), but not when the svg displays inside a html page with the <img ...> tag. ChatGPT correctly identified the issue and suggested a solution using <object ...> tags

Dear Wolfgang, Thanks for your response. No, I haven't tried doing the complete reinstallation as you suggest. If I recall correctly, this has happened on previous occasions but like I said in my email it's not all that disruptive to my workflow. It's more like a 'first world problem'. I was encouraged to submit the query because I had correspondence with someone involved

Hi everybody :) I use R to plot things in svg format. One of the things is text, of course. I noticed that text() in svg() gets saved as path, which is unacceptable for my purposes. (Interestingly, text() in cairo_pdf() gets saved as text.) Is there a way to save text as text in svg? And paths also is what I plot a lot. I know there is segments(), which plots disconnected segments, and things

I am trying to use the RSvgDevice package to produce some SVG graphs which I want to edit with Inkscape 0.42. Under Linux (Kubuntu 5.04) I use the following: library(RSvgDevice) plot(1:10, 1:10) devSVG(file = "/home/adi/Rplots.svg", width = 10, height = 8, bg = "white", fg = "black", onefile=TRUE, xmlHeader=TRUE) but when I tried to load the file into Inkscape it

Hi Is it possible to subset an n-dimensional array by a vector of n dimensions? E.g. assume I have > x <- array(1:24, dim=2:4) > x[1,1,2] [1] 7 > dims <- c(1,1,2) I would like a function that I can supply x and dims as parameters to, and have it return 7. Also, I would like to do something like: > x[1,1,] [1] 1 7 13 19 > dims2<- c(1,1,NA) And have a function of x and

Hi, Does anyone know whether it is possible to construct a colour for plotting with an alpha value as well as simply specifying rgb values? Crispin -------------------------------------------------------- This email is confidential and intended solely for the use o...{{dropped}}

Hi, when running the following on a fresh R, library("IRanges") annotation showMethods("annotation") Biobase:::annotation showMethods("annotation") I get (see the "^^^^^" marked output at the bottom): > library("IRanges") Carico il pacchetto richiesto: 'IRanges' The following object(s) are masked from package:base :

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

Dear all, I have a code chunk in my Rnw file that, when executed, outputs carriage return characters ('\r') to inform on the progress (e.g. "sweep 4 of 1024\r"). But Sweave interprets this as a newline character, and therefore I get countless pages of output in my vignette where I only really want one line. Any ideas? Thanks E

Hi, I run into following error when using heatmap() for data matrix "xx". Any help is appreciated? "xx" contains many "NA"s. > hv <- heatmap(data.matrix(xx)) Error in hclustfun(distfun(if (symm) x else t(x))) : NA/NaN/Inf in foreign function call (arg 11) Thanks a lot. Yuhong

Hi, I have a set of matrices (MAT.1, MAT.2, ...) and I'd like to perform the same operation on each of them (for simplicity, say . I'm writing a function for this so that it can be repeated for different sets with different numbers of matrices. The matrices have the same number of columns, but do not have the same number of rows. My thought is to loop thru the set. but I'm not sure