Displaying 20 results from an estimated 2000 matches similar to: "Scripting SVG with R"
2007 Mar 06
2
SVG and tooltips, hyperlinks
Dear all,
is there a good way to create SVG plots with R whose elements have
titles (tooltips) or act as hyperlinks?
I am using the RSvgDevice package, which works great - but it doesn't
seem to support the notion that plot objects have titles or are act as
hyperlinks, so I am helping myself by giving the objects funny unique
colors and then postprocessing the .svg file.
I wonder
2009 Dec 28
2
[BioC] make.cdf.package: Error: cannot allocate vector of size 1 Kb
My machine has 8GB memory. I had quit all other programs that might
take a lot of memory when I try the script (before I post the first
message in this thread). The cdf file is of only 741 MB. It is strange
to me to see the error.
On Mon, Dec 28, 2009 at 2:38 AM, Wolfgang Huber <whuber at embl.de> wrote:
> Dear Peng Yu
>
> how big is the RAM of your computer? You could try with
2010 Jan 16
1
"Too many raster images" in devPS.c
Hi,
I am finding the recently added [1] functionality of embedding raster
images into plots on R devices very useful! Thanks to Paul Murrell and
others for providing that. I noted that in
https://svn.r-project.org/R/trunk/src/library/grDevices/src/devPS.c
a macro is defined: #define MAX_RASTERS 64, and consequently, I get
Error in grid.Call.graphics("L_raster", x$raster, x$x, x$y,
2018 Sep 20
3
A different error in sample()
Good day,
The use of "rounding" also doesn't make sense. If The number is halfway between two integers, it is rounded to the nearest even integer.
> round(2.5)
[1] 2
--------------------------------------
Dario Strbenac
University of Sydney
Camperdown NSW 2050
Australia
2010 Feb 12
2
Unexpected behaviour of x[i] when i is a matrix, on Windows
Hi,
when running the following on different instances of R (Linux and
Windows), I get different results. The one for Linux seems to be the
intended / documented one. When using numeric indices rather than
characters, Windows seemed to behave as expected.
-----------On Windows--------------
x = matrix(FALSE, nrow=3, ncol=3)
colnames(x) = LETTERS[1:3]
rownames(x) = letters[1:3]
x
# A
2010 May 28
1
require( "foo (>= 2.1)" )
Hello,
I often find myself writing code like :
if( require( "foo" ) && compareVersion( packageDescription(
"foo")[["Version"]], "2.1" ) < 0 ){
# code that uses version 2.1 of foo
} else {
stop( "could not load version >= 2.1 of foo" )
}
Would it make sense to include something like this in require, library,
etc ...
require(
2013 Mar 01
3
interactive visualizations - anyone use SVGAnnotation?
Hi all:I found some great demonstrations of interactive presentation graphics generated in R with the SVGAnnotation package, here:http://www.omegahat.org/SVGAnnotation/http://www.omegahat.org/SVGAnnotation/SVGAnnotationPaper/SVGAnnotationPaper.htmlI tried to install the package available at that website (it's not on CRAN) and am getting some pretty uninformative errors (see below). My best
2010 Mar 15
2
Strange behavior of assign in a S4 method.
Hi the list,
I define a method that want to change an object without assignation
(foo(x) and not x<-foo(x)) using deparse and assign.
But when the argument of the method does not match *exactly* with the
definition of the generic function, assign does not work...
Anything wrong?
Christophe
#------ Does not work ------#
2016 Apr 11
2
R not responding (must force quit) when saving graphic to PDF (bug?)
Dear colleagues,
I wish to report a problem I encounter when trying to save a graphic to
file. When I produce a graphic and try to save it R becomes unresponsive
and I must force quit, and then restart R. The problem occurs when I try to
overwrite an existing graphic: for example when I made changes to the
graphic and want to save the graphic using the original file name. It only
happens when I
2023 Mar 07
1
insert hyperlink into svg graphic
This was actually the first thing that ChatGPT debugged for me.
The issue was that I was able to click on the link when I displayed the raw SVG in the browser (you can use that to test whether the syntax is even correct), but not when the svg displays inside a html page with the <img ...> tag.
ChatGPT correctly identified the issue and suggested a solution using <object ...> tags
2016 Apr 11
1
R not responding (must force quit) when saving graphic to PDF (bug?)
Dear Wolfgang,
Thanks for your response.
No, I haven't tried doing the complete reinstallation as you suggest. If I
recall correctly, this has happened on previous occasions but like I said
in my email it's not all that disruptive to my workflow. It's more like a
'first world problem'.
I was encouraged to submit the query because I had correspondence with
someone involved
2013 Mar 13
1
2 questions about svg output
Hi everybody :)
I use R to plot things in svg format. One of the things is text, of course.
I noticed that text() in svg() gets saved as path, which is unacceptable
for my purposes. (Interestingly, text() in cairo_pdf() gets saved as text.)
Is there a way to save text as text in svg?
And paths also is what I plot a lot. I know there is segments(), which plots
disconnected segments, and things
2005 Sep 03
1
producing SVG files
I am trying to use the RSvgDevice package to produce some SVG graphs which I
want to edit with Inkscape 0.42.
Under Linux (Kubuntu 5.04) I use the following:
library(RSvgDevice)
plot(1:10, 1:10)
devSVG(file = "/home/adi/Rplots.svg", width = 10, height = 8,
bg = "white", fg = "black", onefile=TRUE, xmlHeader=TRUE)
but when I tried to load the file into Inkscape it
2008 Jul 11
1
Subsetting an array by a vector of dimensions
Hi
Is it possible to subset an n-dimensional array by a vector of n dimensions? E.g. assume I have
> x <- array(1:24, dim=2:4)
> x[1,1,2]
[1] 7
> dims <- c(1,1,2)
I would like a function that I can supply x and dims as parameters to, and have it return 7. Also, I would like to do something like:
> x[1,1,]
[1] 1 7 13 19
> dims2<- c(1,1,NA)
And have a function of x and
2003 Nov 12
2
Alpha values
Hi,
Does anyone know whether it is possible to construct a colour for
plotting with an alpha value as well as simply specifying rgb values?
Crispin
--------------------------------------------------------
This email is confidential and intended solely for the use o...{{dropped}}
2009 Feb 25
1
Unexpected side effect of the ":::" operator on the value of isGeneric
Hi,
when running the following on a fresh R,
library("IRanges")
annotation
showMethods("annotation")
Biobase:::annotation
showMethods("annotation")
I get (see the "^^^^^" marked output at the bottom):
> library("IRanges")
Carico il pacchetto richiesto: 'IRanges'
The following object(s) are masked from package:base :
2008 Jul 15
5
counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Any better solution than this ?
sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G")
_________________________________________________________________
[[alternative HTML version deleted]]
2007 Mar 19
1
Carriage returns and Sweave output
Dear all,
I have a code chunk in my Rnw file that, when executed, outputs
carriage return characters ('\r') to inform on the progress (e.g.
"sweep 4 of 1024\r"). But Sweave interprets this as a newline
character, and therefore I get countless pages of output in my
vignette where I only really want one line. Any ideas?
Thanks
E
2007 Jan 19
1
Error in heatmap()
Hi,
I run into following error when using heatmap() for data matrix "xx".
Any help is appreciated? "xx" contains many "NA"s.
> hv <- heatmap(data.matrix(xx))
Error in hclustfun(distfun(if (symm) x else t(x))) :
NA/NaN/Inf in foreign function call (arg 11)
Thanks a lot.
Yuhong
2007 Jan 21
1
Working with a set of matrices
Hi,
I have a set of matrices (MAT.1, MAT.2, ...) and I'd like to perform the same operation on each of them (for simplicity, say . I'm writing a function for this so that it can be repeated for different sets with different numbers of matrices. The matrices have the same number of columns, but do not have the same number of rows.
My thought is to loop thru the set. but I'm not sure