similar to: Is nested namespace supported?

Hi, In Rcpp, we now have a "Function" class to encapsulate functions (they cover all three kinds, but this may change). To call the function, what we do is generate a call with the function as the first node and then evaluate the call. SEXP stats = PROTECT( R_FindNamespace( mkString( "stats") ) ); SEXP rnorm = PROTECT( findVarInFrame( stats, install( "rnorm") ) )

Hi, Why can't I pass an expression to `within' by way of textual input to the 'parse' function? e.g., > x <- data.frame(a=1:5,b=LETTERS[1:5]) > x a b 1 1 A 2 2 B 3 3 C 4 4 D 5 5 E > within(x, parse(text="a<-a*10; b<-2:6")) a b 1 1 A 2 2 B 3 3 C 4 4 D 5 5 E > within(x, parse(text="a<-a*10; b<-2:6")[[1]]) a b 1 1 A 2 2 B 3

I have 6 or 7 nice constants (for example 1852 meters per nautical mile) I would like to have available to 4 or 5 functions in an R package. In C this would just be a header .h file and I would just "include" I am stuck trying to figure out how to create something like a C header file for an R package. Any ideas?

Un texte encapsul? et encod? dans un jeu de caract?res inconnu a ?t? nettoy?... Nom : non disponible URL : <https://stat.ethz.ch/pipermail/r-help/attachments/20100114/da4bc580/attachment.pl>

Hello, Could someone tell me, how can I select from a dataframe only those columns whose names contain a certain text? For example, if the column names are "Bond1.Creditclass","Bond1.Price","Bond2.Creditclass","Bond2.Price", how do I select only the columns corresponding to Bond1? Thanks a lot, Mihai [[alternative HTML version deleted]]

Dear R-help members, I'm quite new to R and I apologize for my basic question, but I haven't been able to find a solution yet. I try to interpret vector entries as a binary code, but unfortunately every first digit which is zero disappears. So how can I set any number (e.g. x = 10110) to a 8-digit zero fill-up (x = 00010110) in order to address digit indices? Or other way round, how

Hello there, I want to create a string from strings and numbers, here is my code: str <- "name" & toString(20) but it returns me this error: Error in toString(20) : could not find function ".jcall" what did I do wrong? I couldn't find this error anywhere... -- View this message in context: http://n4.nabble.com/Error-with-toString-tp1290327p1290327.html Sent from

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

Hi the list, Is there a way to give a matrix to a C function, and then to use it as a matrix ? I write a function to print a matrix, but I use it as a vector : 1. void printMatrix(double *mTraj,int *nbCol, int *nbLigne){ 2. int i=0,j=0; 3. for(i=0 ; i < *nbLigne ; i++){ 4. for(j=0 ; j < *nbCol ; j++){ 5. Rprintf(" %f",mTraj[i * *nbCol + j]); 6. } 7.

Hi the list, I need to write some efficient distances function, so I read the code for the Euclidean distance. I do not understand the purpose of the line 11 : if x[i] and y[i] are not NA (line 9), can dev be NA ? Christophe #define both_FINITE(a,b) (R_FINITE(a) && R_FINITE(b)) #define both_non_NA(a,b) (!ISNAN(a) && !ISNAN(b)) 1. static double R_euclidean2(double *x, double

I have been working on an R package that calls C code using .C(). I recently started including some functions from the GNU Scientific Library in my code. The code runs fine on my machine when not wrapped in the package. But I get the following error from "R CMD check" * checking whether the package can be loaded ... ERROR Loading required package: splancs Loading required package: sp

Hello All, I am trying to create a column of weights based off of factor levels from another column. I am using the weights to calculate L scores. Here is an example where the first column are scores, the second is my "factor" and the third I want to be a column of weights. I can do what I want with an ifelse statement (see below), but I am wondering if anyone knows of a cleaner way

Here is the code in question: describe UsersController do render_views … … describe "POST to ''create'' action" do describe "failure" do before(:each) do @attr = { :name => '''', :email => '''', :password => '''', :password_confirmation =>

Dear List Sorry if this question seems very basic. Is there a function to pro grammatically find number of processors in my system _ I want to pass this as a parameter to snow in some serial code to parallel code functions Regards Ajay Websites- http://decisionstats.com http://dudeofdata.com Linkedin- www.linkedin.com/in/ajayohri

[Disclaimer: what is below reflects my understanding from reading the R source, others will correct where deemed necessary] On 1/2/10 12:00 PM, r-devel-request at r-project.org wrote: > > Hello, > > We are currently making lots of changes to Rcpp (see the open Rcpp > mailing list if interested [1] in the details). > > We are now using [2] R_PreserveObject and R_ReleaseObject

Hello all, My partner was just debugging a project that had tried to call a function without arguments in the code but the declaration wasn't declared with a void parameter list. It failed with an assertion that something was trying to ++ past the end of an ilist. I seem to remember Chris Lattner saying when he made the hand written AsmParser that it wasn't intended to be very robust

Hi all, I have the following issue, and I hope someone know a way to handle it. I need to grammatically need to create/install a guest OS using the libvirt API. Currently what I do: 1. create a xml with the vm configuration (this will include a path to the iso image) 2. connection.defineXML(<my_config>) 3. vm = connection.lookupByName(<domain_name>) 4. vm.create() This will

On Nov 13, 2009, at 10:16 AM, Samuel Crow wrote: > Hello all, > > My partner was just debugging a project that had tried to call a > function without arguments in the code but the declaration wasn't > declared with a void parameter list. It failed with an assertion > that something was trying to ++ past the end of an ilist. > > I seem to remember Chris Lattner

In putting together the SoundPack code, I am looking at the various language/locale specific code, and wondering how it all really stands... So, share with me, non-English speakers, what is your experience and impression? I heard a few comments during AstriDevCon, that some of the languages are not quite right; some said their language was understandable, but... Would anyone be willing to share

Hello, this is quite a minor issue but as summary() is in all likelihood one of the most widely used functions in R I decided to email this list. When producing a count of missing values, summary() in English generates an unnecessary and grammatically incorrect apostrophe (NA's rather than NAs) in its table header. For example: > summary(c(1,2,NA,3,4,NA)) Min. 1st Qu. Median Mean