similar to: Extract method for a new class

Dear list, making mathematical expressions in plots is not difficult: expression(phi[1]) for example. At this moment I am stuck in creating a vector of expressions: pos <- 1:10 lab <- letters[pos] Now, I would like to create a vector of expressions which I could use for labeling the x-axis of a lattice plot. ll <- as.expression(paste(pos," phi[",lab,"]",sep =

Dear list, I am trying to develop a package. I used the function package.skeleton to make the directory tree of the package and then build and compiled the package as described (I hope). Now, I would like to increase the number of functions in the package without overwriting the existing package directory tree, so I put these new functions in the directory R of the tree. When I then build and

Hello list, I am making graphics for an article which I want to publish. The article is about several methods (to calculate breeding values of individuals) applied in several genetic scenarios (scen1 in the example) and using data from two sources (scen 2 in my example). I want to specify the ylim of my plot and have relation = 'free' for the yaxis but I would to avoid plotting the axis

Greetings, I cvsup'd and rebuilt a FreeBSD 4.8 system last Friday after receiving the realpath security advisory. The machine is remote and the NIC uses the rl driver. After booting the machine I had no network connectivity. The person at the remote site says the boot was normal and he could see that the NIC was properly configured but he could not ping it and I could not login. We booted

Hello, How can I read a xlsx file using xlsx package? Thanks Albert [[alternative HTML version deleted]]

Dear all, I have a file with some sequence (seq.txt). I am writting following code and getting error! Can please help me? seqfile<-read.table(file="seq.txt") Warning message: In read.table(file = "seq.txt") : incomplete final line found by readTableHeader on 'seq.txt' Thanks in advance Albert -------------- next part -------------- NNNNNNNNNNATTAAAGGGC

Dear all, I have a input file like following : AAAAT TTTAG TTAAC GGATT ACGTA How can I make a single vector with this like following: AAAATTTTAGTTAACGGATTACGTA Best regards Albert [[alternative HTML version deleted]]

Hello, I have started to use RMySQL and I would like to use R to make batch changes to data. What it the best way to do this? Is it to download the table using dbGetQuery, manipulate the data in R and then dbWriteTable to delete the existing table and replace it with the local data. What I am concerned about this is that it might lose some mySQL table configuration options and it isn't a

Is anyone out there using any of the newer linksys phones since Cisco took over? I am more specifically looking at the spa-941 & 942's. Just curious about call quality, programability, and functionality with asterisk. I have read through the literature, but would like some real world feedback. Thanks

Hallo Group! My Name is Guenther Sohler and I registred to this group, because I think asterisk could be interesting for me. I have got a small server at home running linux. It does NAT and a Firewall. There is an intranet with my home PC and a hardware SIP phone. This SIP phone registers at mujtelefon.cz Now I got another account at sipgate.at My idea is following: I want to be reachable at

Hi there, I'm rying to 'turn' an Schunk in an .Rnw file(Xemacs-21.4.13, ESS-5.2.8, R-2.1, miktex-2.4.1705). Has anyone got the isorot package to work with Sweave? JC example test.Rnw: \documentclass[a4paper]{article} \usepackage{Sweave} \usepackage{isorot} \rotdriver{dvips} \clockwise \title{Sweave Example 1} \author{apologies to Friedrich Leisch } \begin{document} \maketitle