similar to: developing a package: increase the number of functions

Dear list, I am trying to write a package for simulating meioses in R. We defined a class 'haplotype' which contains the basic units of our simulation: setClass("haplotype",representation(snp = "numeric",qtl = "list", hID = "numeric",phID0 = "numeric",phID1 = "numeric"),

Dear list, making mathematical expressions in plots is not difficult: expression(phi[1]) for example. At this moment I am stuck in creating a vector of expressions: pos <- 1:10 lab <- letters[pos] Now, I would like to create a vector of expressions which I could use for labeling the x-axis of a lattice plot. ll <- as.expression(paste(pos," phi[",lab,"]",sep =

Hello list, I am making graphics for an article which I want to publish. The article is about several methods (to calculate breeding values of individuals) applied in several genetic scenarios (scen1 in the example) and using data from two sources (scen 2 in my example). I want to specify the ylim of my plot and have relation = 'free' for the yaxis but I would to avoid plotting the axis

Hello, How can I read a xlsx file using xlsx package? Thanks Albert [[alternative HTML version deleted]]

Dear all, I have a file with some sequence (seq.txt). I am writting following code and getting error! Can please help me? seqfile<-read.table(file="seq.txt") Warning message: In read.table(file = "seq.txt") : incomplete final line found by readTableHeader on 'seq.txt' Thanks in advance Albert -------------- next part -------------- NNNNNNNNNNATTAAAGGGC

Hi! I've been browsing through the last months' archive and I can't find an answer to my question, so here it is (let's hope it's not too obvious): I'm working on extensions of an R library, and I would be very surprised if everyone developing R packages is doing the following, as I do: 1.- Write down a modification of an R file 2.- Exit the current R

Dear all, I have a input file like following : AAAAT TTTAG TTAAC GGATT ACGTA How can I make a single vector with this like following: AAAATTTTAGTTAACGGATTACGTA Best regards Albert [[alternative HTML version deleted]]

Dear all, I am a new user of R and currently trying hard to develop my own package. Here I am following this tutorial 'http://www.mathfinance.cn/how-to-create-an-R-package-in-windows/' Here it says that (step 8): "open a ?command prompt? window, change the directory to where your package is, type the command ?R CMD build MonteCarloPi? to build the package, this will generate a file

Hi I have a package which was built using R 1.9.1 and everything worked fine. I recently upgraded to R 2.0.1 and tried to re-install my package - and I got: Error in library(mypackage) : 'mypackage' is not a valid package -- installed < 2.0.0? So I tried rebuilding it using my new version of R: R CMD BUILD --binary mypackage hhc: not found cp: cannot stat `mypackage.chm': No

Function/file names are hypothetical. Say I have written myfunction.R, which calls myfunction.c via .C("myfunction", ...). I've compiled successfully myfunction.c via R CMD SHLIB myfunction.c in the terminal. Then, in the R console: dyn.load("myfunction.so") source("myfunction.R") test <- myfunction() # works fine So everything is in order, myfunction works

Hello. I have what I know to be a simple question, but never having done anything like this it is pretty tough. I'm trying to write an R package. I have a collection of functions that I loaded into R and then used package.skeleton(). After editing everything in the resulting folder, call it NewPackage, I tried to follow along with some instructions I found for Windows users. I installed

I have some questions about 1. nomenclature, 2. recommended file locations and 3. overall procedure related to creating packages. To the extent that it matters, examples here relate to Windows XP R 2.0.1 beta. The questions are interspersed and prefaced with ***. My understanding is that there are actually 6 forms of a package that one should use in package development: 1.

Dear friends, I am building an R package called *mypackage*. I followed every possible steps (to my understanding) for the same. I got following problem while doing *R CMD check mypackage*. * installing *source* package 'mypackage' ... ** libs cygwin warning: MS-DOS style path detected: C:/PROGRA~1/R/R-213~1.0/etc/i386/Makeconf Preferred POSIX equivalent is:

I'm putting together an R package. I would like to show example code in the vignette, where example data files (included in the package) are used to generate an (example) output file. I read about using example data in Hadley Wickham's post ( http://r-pkgs.had.co.nz/data.html), and believe I should keep my example data as raw data, as it must be parsed to generate the output. So, I

Hi, I need to link mypackage to 2 other packages so I can call some C functions defined in these 2 packages from mine. I've tried Depends: packageA, packageB LinkingTo: packageA, packageB as suggested by the "5.4 Registering native routines" section of the "Writing R Extensions" manual but then only packageA is seen at compilation time (gcc is called with

I have question regarding package installation. What is the difference between check, INSTALL, build and build --binary, which imply which and what order does one normally perform them? I have been trying: R CMD build /mypackage R CMD check /mypackage R CMD build --binary /mypackage in that order but wanted to check that this is right. Also, what portion of the check process can be run

Hi I found yum-downloadonly and executed my command do that and save the dependencies in my current directory. Now when I execute my command: rpm -i mypackage all the dependencies are not found even though they are in the current directory. if I do a "yum install mypackage" (and its in the current directory) its not found either. How do I now install the mypackage in the current

Dear List, I’m doing my first baby steps towards developing own R Packages and ran into the following problem: R CMD check mypackage works fine (no errors, no warnings) R CMD build mypackage works fine (no errors, no warnings) R CMD INSTALL –library=”C:\R\R-2.11.1\library” “something\mypackage\mypackage_1.0.tar.gz” works fine (no errors, no warnings) However, when I try loading the

Dear List, I’m doing my first baby steps towards developing own R Packages and ran into the following problem: R CMD check mypackage works fine (no errors, no warnings) R CMD build mypackage works fine (no errors, no warnings) R CMD INSTALL –library=”C:\R\R-2.11.1\library” “something\mypackage\mypackage_1.0.tar.gz” works fine (no errors, no warnings) However, when I try loading the

When I run the following: cd \Rpkgs rcmd install mypackage -l library I get a message that it cannot find quadprog which is a library that mypackage depends on. Error: package 'quadprog' could not be loaded I previously used C:\Program Files\R\rw2011\library as my library for CRAN packages and did not have a problem but now that I use C:\Program Files\R\library this problem