similar to: Accessing data files w/ --use-zip-data

Displaying 20 results from an estimated 1700 matches similar to: "Accessing data files w/ --use-zip-data"

2009 Feb 04
3
auth_debug_passwords
Hi. I'm new to Dovecot and about to start using it in production. In the config file, I set the option, auth_debug_passwords, to yes. I do not see any failed passwords logged, however. It did cause more verbose authentication logging, but failed passwords are still hidden. I have also set these options to yes, because I thought they might be required for auth_debug_passwords to work:
2003 Dec 17
2
Can't start R-devel
Hello ... With a new checkout of R-devel, I'm getting the following error on startup: Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for a HTML browser interface to help. Type 'q()' to quit R. Error in open.connection(con, "rb") : unable to open connection In addition: Warning message: cannot open compressed file
2004 Aug 23
2
Installing package lattice
Here's another issue (that might well be operator error): > install.packages("lattice") ... ... ** save image Loading required package: grid Error in importIntoEnv(impenv, impnames, ns, impvars) : object(s) 'dev.list', 'cm.colors', 'gray', 'heat.colors' are not exported by 'namespace:graphics' Execution halted ERROR: execution of
2003 May 23
1
Problem building R-devel
Hello ... I went to build R-devel today (Redhat Linux 7.2, kernel 2.4.9-31, gcc 2.96) and am getting this error: gcc -I../../src/extra/zlib -I. -I../../src/include -I../../src/include -I/usr/local/include -DHAVE_CONFIG_H -D__NO_MATH_INLINES -mieee-fp -g -O2 -c pcre.c -o pcre.o pcre.c: In function `do_pgrep': pcre.c:71: parse error before `char' pcre.c:72: `s' undeclared (first use
2003 Sep 16
2
couldn't find function "setClass"
Hello ... With a new checkout of R-devel (last update was 2003-09-11) we are having a problem (it seems to be happening to all of us here on a few different machines) where during install/check/etc when the 'save image' happens (in packages using 'save image'): ** save image Error: couldn't find function "setClass" Execution halted This is for all packages that
2004 Mar 31
2
segfault in browseURL()
Hello ... Using Win2K (and reportedly WinXP), when the length of the 'url' string >= 280 characters, a segmentation fault occurs. This doesn't seem to be affecting unix machines. Thanks -J
2003 Nov 13
2
install.packages() for a local file
Hello ... I see that on Windows one can specify a filename as the "pkgs" argument and then set CRAN=NULL when calling install.packages() for a local file. Is there a way to do this on unix? It doesn't appear to be possible, but perhaps I am missing something here. Also, if indeed there is no method to do this on unix, is there a reason behind it or has it just never been
2006 Sep 28
1
Build error/zlib question
Hi, I am unable to build a package I maintain using a relatively current build of R-2.4.0 alpha, whereas the package builds just fine on R-2.3.1. Both versions of R were built from source. I'm hoping a guRu might be able to give some help. Some snippets from the build process: R-2.3.1 making DLL ... gcc -Ic:/R-2.3.1/src/extra/zlib -DHAVE_ZLIB -Ic:/R-2.3.1/include -Wall -O2 -c
2005 Jul 19
1
Problem building R
I initially thought this only was the case for me on R-devel, but also just tested it on the current R-patched and R-2.1.1 (so perhaps this more belongs on R-help, but ...). I'm having an odd error with the makefiles in src/library/XXX while building R. When it tries to create the 'po' directory, the Makefile specifies: @if test -d $(srcdir)/inst/po; then \ $(MKINSTALLDIRS)
2004 Aug 23
1
Possible Latex problem in R-devel?
I'm getting this error when installing packages w/ a checkout of R from a a little bit ago (23-Aug-2004, approx 1pm eastern US time): ** help Bareword found where operator expected at /usr/home/jgentry/R/share/perl/R/Rdconv.pm line 2331, near "$latexout latex_link_trans0" (Missing operator before latex_link_trans0?) It isn't obvious to me what the error is, although
2009 Dec 28
2
[BioC] make.cdf.package: Error: cannot allocate vector of size 1 Kb
My machine has 8GB memory. I had quit all other programs that might take a lot of memory when I try the script (before I post the first message in this thread). The cdf file is of only 741 MB. It is strange to me to see the error. On Mon, Dec 28, 2009 at 2:38 AM, Wolfgang Huber <whuber at embl.de> wrote: > Dear Peng Yu > > how big is the RAM of your computer? You could try with
2006 Nov 11
1
Install bioconductor
Hello useRs, I'm trying to install bioconductor on ubuntu edgy eft and R 2.4.0. I have some error messages during installation, in particular for the package "affy" : "Error: package 'affy' required by 'makecdfenv' could not be found" I have tryed to install 'makecdfenv' with the command : getBioC("makecdfenv") But I have this message
2007 Oct 30
6
trouble installing building packages from source using R 2.6.0 on Ubuntu Gutsy AMD64
I have recently upgraded to Ubuntu Gutsy and, for the first time, am using a 64-bit installation. After failing miserably to install R from source, not a problem for me in the past with a 32-bit install, I went the route of using the Debian Etch build. This went smoothly, but I am unable to update my numerous R and BioConductor packages, getting non-zero exit status errors on each package. Is
2003 Apr 28
1
installed.packages() with no packages
Hello ... I found this due to a situation where installed.packages() was given a lib.loc argument that turned out to not have any R packages installed. As an example: > z <- tempfile() > dir.create(z) > installed.packages(z) Error in "colnames<-"(*tmp*, value = c("Package", "LibPath", pkgFlds)) : dimnames applied to non-array Looking at the code,
2004 May 14
2
rma and gcrma do not work in R 1.9.0
I run R 1.9.0 on windows 2000, and have the following libraries installed: affydata_1.3.1 affy_1.4.23 Biobase_1.4.10 DynDoc_1.3.14 gcrma_1.0.6 hgu133acdf_1.4.3 hgu95av2cdf_1.4.3 hgu95av2probe_1.0 matchprobes_1.0.7 moe430acdf_1.4.3 multcomp_0.4-6 mvtnorm_0.6-6 rae230acdf_1.4.3 reposTools_1.3.29 rgu34acdf_1.4.3 tkWidgets_1.5.1 widgetTools_1.2.7 1. The rma function (in affy library) always crashes.
2011 May 08
2
Error in AnnotationDbi package - makeProbePackage
Dear all, We have developed our own Affymetrix chip (Custom Express Array, PM-only with two species). I want to analyse the data with the limma package, but for that I need to built my own CDF package, probe package and built the filters to analyse one specie or another. I'm using the makeProbePackage available in the AnnotationDbi (for a R-2.13.0) but I got the following error message:
2003 Oct 30
0
Release of Bioconductor 1.3
The Bioconductor core group would like to announce the 1.3 release of the Bioconductor software. There are many new packages as well as several major upgrades and fixes in older packages, and users are encouraged to check them out. Release 1.3 is intended to be operated with R version 1.8.X, which can be obtained at CRAN (http://cran.r-project.org/) -- WHAT FEATURES DOES THIS RELEASE PROVIDE?
2003 Oct 30
0
Release of Bioconductor 1.3
The Bioconductor core group would like to announce the 1.3 release of the Bioconductor software. There are many new packages as well as several major upgrades and fixes in older packages, and users are encouraged to check them out. Release 1.3 is intended to be operated with R version 1.8.X, which can be obtained at CRAN (http://cran.r-project.org/) -- WHAT FEATURES DOES THIS RELEASE PROVIDE?
2008 Jul 15
5
counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]
2003 Aug 07
5
gregmisc
Hi How do I install "gregmisc" packages? I did- % sudo R > install.packages("gregmisc") . . > barplot2() but, Error: couldn't find function "barplot2" -- atuya Mac OSX 10.2.6 R 1.7.1