similar to: R shell script

Hey guys, can anyone help? i have a sample table: >table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11, 8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1", "gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2", "codon3"))) >table codon1 codon2 codon3 gene1 4.0 7

Hey guys, I'd really appreciate any help. I have a multivariate analysis done, the output of which is: > GraphData <-read.table("eigen.coa") > GraphData V1 V2 V3 V4 1 1 0.371970 0.8552 0.8552 2 2 0.061785 0.1420 0.9972 3 3 0.001211 0.0028 1.0000 4 4 0.000000 0.0000 1.0000 > summary(GraphData) V1 V2 V3

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Dear R users, A co-worker and I are writing a function to facilitate graph plotting in R. The function makes use of a lot of lists in its defaults. However, we discovered that R does not necessarily preserve the defaults if we were to input them in the form of list() when initializing the function. For example, if you feed the function codes below into R: myfunction=function( list1=list

Hi, I have 2 questions on list object:   1. Suppose I have a matrix like: dat <- matrix(1:9,3)   Now I want to replicate this entire matrix 3 times and put entire result in a list object. Means, if "res" is the resulting list then I should have:   res[[1]]=dat, res[[2]]=dat, res[[3]]=dat   How can I do that in the easilest manner?   2. Suppose I have 2 list objects: list1 <- list2

Hi, Algorithm question: I have two sets of "intervals", where an interval is an ordered pair [a,b] of two numbers. Is there an efficient way in R to generate the intersection of two lists of same? For concreteness: I'm representing a set of intervals with a data.frame: > list1 = as.data.frame(list(open=c(1,5), close=c(2,10))) > list1 open close 1 1 2 2 5

Hey guys, if i do a correspondance analysis, e.g.: table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11, 8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1", "gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2", "codon3"))) Library(ca) plot(ca(table)) is there a way that i can see

Hello I have two lists of numbers, each list is ~800 numbers long. I want to know if the two lists are significantly different from each other. Could anyone suggest what library in R to use? I think maybe the mann-whitney test, as it is not parametric, but i am unsure if it is suitable as my list of items are so long.So i am unsure which library would suit best. Aaral. [[alternative HTML

Hi, This has bugged me for a bit. First question is how to keep classes with rbind, and second question is how to properly return vecotrs instead of lists after turning an rbind of lists into a data.frame list1=list(a=2, b=as.Date("20090102", format="%Y%m%d")) list2=list(a=2, b=as.Date("20090102", format="%Y%m%d")) rbind(list1, list2) #this loses the

I am new to R, and I have been running into the following situation when I mistype a variable name in some code: > list1 <- list( a=1, b=2 ) > list2 <- list( a=1 ) > list2$b <- list1$c > list2 $a [1] 1 I would think at the point where I am trying to reference a field called "c" -- that does not exist -- in list1, there would be an error flagged. Instead, list1$c

Hi, I am wondering whether we can apply 'cbind/rbind' on many **equivalent** list objects. For example please consider following: > list1 <- list2 <- vector("list", length=2); names(list1) <- names(list2) <- c("a", "b") > list1[[1]] <- matrix(1:25, 5) > list1[[2]] <- matrix(2:26, 5) > list2[[1]] <- 10:14 > list2[[2]] <-

R-helpers: Say I have two lists of arbitrary elements, e.g.: list1=list(c(1:3),"R is fun!",c(3:6)) list2=list(c(10:5),c(5:3),c(13,5),"I am so confused") I would like to produce a single new list that is composed of all combinations of the "top level" of list1 and list2, e.g.: listcombo=list(list(list1[[1]],list2[[1]]),list(list1[[1]],list2[[2]]

Hi, I have two lists 1) List1- 30,000 rows and 104 columns 2) List2- a list of 14000 selected rownames  from List 1 Now, I want to extract all the 104 columns of List1  matching with the 14000 selected rownames from List2.  Psedocode will be something like this: match rownames(List2) with rownames(List1) extract selected matched 104 coloumns from (List1) strore in-> List3 So the

hi, i'm trying to figure out if there's any possibility to write a whole vector into a matrix or data.frame or something like that. i don't mean transormation. Here an example: [,1] [,2] [1,] "a" "d" [2,] "b" "e" [3,] "c" "f" where e.g. a is a<-c(0,1) vector of length 2, b a vector of length 4,... (i know that

Hello, am I using 'setIs' in the correct way in the subsequent (artifical) example? Do I have to specify explicit 'setAs' for 'list' and 'vector' or should this work automatically, since "getClass("List1")" states an explicit coerce also for these classes. I'm working with R 2.0.0 Patched (2004-10-06) on windows 2000. Thanks for your

Hi. I read most of the postings here but unfortunately I didin''t found a complete example which could be used. Of cource the ones who are professionals in javascript could implement the missing peaces from the puzzle. What I''m required to do is a tree (sortable list) where items can also be deleted and at each modification a function (ajax) is called to save the changes. For

I have the following code: list1 <- list() for (i in list.files(pattern="filename1")){ x <- read.table(i) list1[[i]] <- x } list2 <- list() for (i in list.files(pattern="filename2*")){ x <- read.table(i) list2[[i]] <- x } anslist <- vector('list', length(list1)) for(i in 1:length(list1)) if (list1[[i]] & list2[[i]] >1)

Hi guys, I still did not solve my problem properly! I have to compare the values of two lists of 250 numbers as a result of using the ?by function! List1 of 250  $ 0   : num [1:28] 22 11 31...  $ 1   : num [1:15] 12 14 9 ... .. .. ..  - attr(*, "dim")= int 250  - attr(*, "dimnames")=List of 1 List2 of 250  $ 0   : num [1:24] 20 12 22...  $ 1   : num [1:17] 11 12 19 ... .. ..

Hi R users I was wondering on how to use lapply & co when the applied function has a conditional statement and the output is a 'growing' object. See example below: list1 <- list('A','B','C') list2 <- c() myfun <- function(x,list2) { one_elem <- x cat('one_elem= ', one_elem, '\n') random <- sample(1:2,1) show(random)

Silly question, but, can I test to see if any value of list a is contained in list b without doing a loop? A loop is easy enough, but wanted to see if there was a cleaner way. By way of example: List 1: a, b, c, d, e, f, g List 2: z, y, x, w, v, u, b Return true, since both lists contain b List 1: a, b, c, d, e, f, g List 2: z, y, x, w, v, u, t Return false, since the lists have no mutual