Displaying 20 results from an estimated 100 matches similar to: "Help using R 2.14.2"
2004 Jan 06
0
Boost Protein Expression by Codon Optimization
Dear Colleague,
Happy New Year!
As we know, codon preference among different species could be dramatically different. To enhance the expression level of a foreign protein in a particular expression system (E.coli, Yeast, Insect, or Mammalian cell), it is very important to adjust the codon frequency of the foreign protein to match that of the host expression system. One classic example is GFP
2004 Jan 08
1
Boost Protein Expression by Codon Optimization
Dear Colleague,
Happy New Year!
As we know, codon preference among different species could be dramatically different. To enhance the expression level of a foreign protein in a particular expression system (E.coli, Yeast, Insect, or Mammalian cell), it is very important to adjust the codon frequency of the foreign protein to match that of the host expression system. One classic example is GFP
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2006 Mar 13
1
Building help pages
Hello!
I was just wondering, why only one of my "Rd" files is converted in
"chm" format (REGE) and the other are not when installing a package? The
output from installing a package on WinXp is below.
I tried to find more information about what "chm" format actually is,
however have found none.
Best regards and thaks for any replies,
Ales Ziberna
2005 Dec 08
1
description of HFSC qdisc module
Hi,
is there a good commandline parameter reference for the sch_hfsc.o
module? i googled half a day with no luck. can someone please be so kind
to send a weblink or post the reference on nopaste or something like this.
regards
uwe
2012 Nov 07
1
total number of citations for R project
Dear Member list,
is there a weblink or a paper where the total number of citations for R
project is report?
Thanks in advance
Gianni
[[alternative HTML version deleted]]
2001 Sep 13
0
sftp
Afternoon,
I am in the process of putting openssh onto our NT servers as a remote
command console and all is going well with sshd. I tried to add the
sftp-server into the config file and it will not connect.
The error I get is: Recieved message too long 1298752370
The I added to the sshd config file is: Subsystem sftp
c:\ssh\sftp-server.exe
Where c:\ssh is where the program located.
Any ideas?
2014 Dec 03
0
partedmagic connecting to a comcast address
On 12/3/2014 12:47 PM, g wrote:
> wireshark text file loaded at;
>
> http://pastebin.com/rCU0CC10
some device on your network has the MAC address 00:0f:fe:8f:8f:23 which
Wireshark is calling PartedMagic for unknown reasons. That MAC prefix
apparently belongs to an obscure Chinese computer maker, G-Pro Computers.
http://macaddress.webwat.ch/vendor/G-PRO_COMPUTER
the weblink given
2001 Sep 14
0
News from the www.indymedia.org:8081 newswire
---------------------------------------------------------------
Story from the www.indymedia.org:8081 newswire
Checkout independent media coverage of politics, protest, and life
at: http://www.indymedia.org:8081
This message was sent to you by: concerned citizen
Comments: I just thought this might be interesting in the context of free music distribiuton
2007 May 17
2
How to analyse simple study: Placebo-controlled (2 groups) repeated measurements (ANOVA, ANCOA???)
Hallo!
I have two groups (placebo/verum), every subject is measured at 5 times, the first time t0 is the baseline measurement, t1 to t4 are the measurements after applying the medication (placebo or verum). The question is, if there is a significant difference in the two groups and how large the differnce is (95% confidence intervals).
Let me give sample data
# Data
2014 Dec 03
3
partedmagic connecting to a comcast address
John,
thank you for replying.
On 12/03/2014 03:21 PM, John R Pierce wrote:
> On 12/3/2014 12:47 PM, g wrote:
>> wireshark text file loaded at;
>>
>> http://pastebin.com/rCU0CC10
>
> some device on your network has the MAC address 00:0f:fe:8f:8f:23
> which Wireshark is calling PartedMagic for unknown reasons.
see my new paste at;
http://pastebin.com/8vBxnUSf
2004 Aug 06
0
gen-mpegurl.m3u source/making a clean weblink to broadcast
on Thursday 28 March 2002 22:48, icecast@chile.junglevision.com wrote:
> Hi guys. I've been running icecast for awhile, and just
> upgraded to the latest version. Everything works fine,
> nice work.
>
> Here's the deal, I'm still not sure how to make a clean
> link to my broadcast. On the icecast.org site, it calls
> a cgi-bin file called
2004 Aug 06
0
gen-mpegurl.m3u source/making a clean weblink to broadcast
On Fri, Mar 29, 2002 at 06:52:39PM -0800, icecast@chile.junglevision.com wrote:
> Thanks guys, this is exactly what I was looking for. Now, all
> I have to do is figure out how to start icecast and liveice
> cleanly when the machine cycles power.
>
> I tried just naively sticking
>
> /usr/local/icecast/bin/icecast &
> /usr/local/icecast/bin/liveice &
>
>
2008 Apr 02
0
new member introduction and informal weblink exchange entertanment
Rythmomachy is a member of GotoMy.com and is inviting you to join our new community site!
Rythmomachy Says:
WELCOM
Join GotoMy.com
2004 Aug 06
2
gen-mpegurl.m3u source/making a clean weblink to broadcast
Thanks guys, this is exactly what I was looking for. Now, all
I have to do is figure out how to start icecast and liveice
cleanly when the machine cycles power.
I tried just naively sticking
/usr/local/icecast/bin/icecast &
/usr/local/icecast/bin/liveice &
into rc.local, but something weird happens. It just loops
on a message 'you can run but you can't hide' over and
over
2004 Aug 06
2
gen-mpegurl.m3u source/making a clean weblink to broadcast
Hi guys. I've been running icecast for awhile, and just
upgraded to the latest version. Everything works fine,
nice work.
Here's the deal, I'm still not sure how to make a clean
link to my broadcast. On the icecast.org site, it calls
a cgi-bin file called 'gen-mpegurl.m3u.' This always
stars up my broadcast nicely.
Is there anyway to get the source code to
2015 May 28
3
[PATCH v2 8/9] acpi: Add support for Apple Gmux _DMS
Hi Dave,
----- Mail original -----
> Changes since v1:
[...]
> diff --git a/drm/nouveau/nouveau_vga.c b/drm/nouveau/nouveau_vga.c
> index 9a6328f..7b13804 100644
> --- a/drm/nouveau/nouveau_vga.c
> +++ b/drm/nouveau/nouveau_vga.c
> @@ -36,7 +36,7 @@ nouveau_switcheroo_set_state(struct pci_dev *pdev,
> {
> struct drm_device *dev = pci_get_drvdata(pdev);
>
> - if
2014 Dec 03
2
partedmagic connecting to a comcast address
On 12/03/2014 11:13 AM, Mark Milhollan wrote:
<>
> Do you mean PartedMagic as the destination port? If so that's just a
> translation from the port number to a name found in your /etc/services
> file. It is often wrong or misleading, and in most cases can be
> ignored.
i have no PartedMagic in /etc/services
>> NetName: COMCAST-VOIP-4
>
> Given this
2006 Apr 09
3
Instant Message?
Hi all,
My client softphone supports IM feature. Does any warmheated expert know if
Asterisk can support IM also at server side? If so, is there any
related documents or weblinks?
--
Thanks & Best Regards!
Steven Li
-------------- next part --------------
An HTML attachment was scrubbed...
URL: http://lists.digium.com/pipermail/asterisk-users/attachments/20060409/f131bc17/attachment.htm
2008 Jul 16
1
rsync+ZFS snapshot
Hi All,
I am not so expert on rsync. I am using windows XP and Vista.
I am able to take the backup using rsync.(It does not give the incremental)
I need to take incremental also. After some googling (referring the link- http://www.jeffawaddell.com/2008_04_01_archive.html) I found that rsync + ZFS snapshot does the same job. It use rsync to make delta backups to the file server, and automatic ZFS