similar to: Help using R 2.14.2

Dear Colleague, Happy New Year! As we know, codon preference among different species could be dramatically different. To enhance the expression level of a foreign protein in a particular expression system (E.coli, Yeast, Insect, or Mammalian cell), it is very important to adjust the codon frequency of the foreign protein to match that of the host expression system. One classic example is GFP

Dear Colleague, Happy New Year! As we know, codon preference among different species could be dramatically different. To enhance the expression level of a foreign protein in a particular expression system (E.coli, Yeast, Insect, or Mammalian cell), it is very important to adjust the codon frequency of the foreign protein to match that of the host expression system. One classic example is GFP

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Hello! I was just wondering, why only one of my "Rd" files is converted in "chm" format (REGE) and the other are not when installing a package? The output from installing a package on WinXp is below. I tried to find more information about what "chm" format actually is, however have found none. Best regards and thaks for any replies, Ales Ziberna

Hi, is there a good commandline parameter reference for the sch_hfsc.o module? i googled half a day with no luck. can someone please be so kind to send a weblink or post the reference on nopaste or something like this. regards uwe

Dear Member list, is there a weblink or a paper where the total number of citations for R project is report? Thanks in advance Gianni [[alternative HTML version deleted]]

Afternoon, I am in the process of putting openssh onto our NT servers as a remote command console and all is going well with sshd. I tried to add the sftp-server into the config file and it will not connect. The error I get is: Recieved message too long 1298752370 The I added to the sshd config file is: Subsystem sftp c:\ssh\sftp-server.exe Where c:\ssh is where the program located. Any ideas?

On 12/3/2014 12:47 PM, g wrote: > wireshark text file loaded at; > > http://pastebin.com/rCU0CC10 some device on your network has the MAC address 00:0f:fe:8f:8f:23 which Wireshark is calling PartedMagic for unknown reasons. That MAC prefix apparently belongs to an obscure Chinese computer maker, G-Pro Computers. http://macaddress.webwat.ch/vendor/G-PRO_COMPUTER the weblink given

--------------------------------------------------------------- Story from the www.indymedia.org:8081 newswire Checkout independent media coverage of politics, protest, and life at: http://www.indymedia.org:8081 This message was sent to you by: concerned citizen Comments: I just thought this might be interesting in the context of free music distribiuton

Hallo! I have two groups (placebo/verum), every subject is measured at 5 times, the first time t0 is the baseline measurement, t1 to t4 are the measurements after applying the medication (placebo or verum). The question is, if there is a significant difference in the two groups and how large the differnce is (95% confidence intervals). Let me give sample data # Data

John, thank you for replying. On 12/03/2014 03:21 PM, John R Pierce wrote: > On 12/3/2014 12:47 PM, g wrote: >> wireshark text file loaded at; >> >> http://pastebin.com/rCU0CC10 > > some device on your network has the MAC address 00:0f:fe:8f:8f:23 > which Wireshark is calling PartedMagic for unknown reasons. see my new paste at; http://pastebin.com/8vBxnUSf

on Thursday 28 March 2002 22:48, icecast@chile.junglevision.com wrote: > Hi guys. I've been running icecast for awhile, and just > upgraded to the latest version. Everything works fine, > nice work. > > Here's the deal, I'm still not sure how to make a clean > link to my broadcast. On the icecast.org site, it calls > a cgi-bin file called

On Fri, Mar 29, 2002 at 06:52:39PM -0800, icecast@chile.junglevision.com wrote: > Thanks guys, this is exactly what I was looking for. Now, all > I have to do is figure out how to start icecast and liveice > cleanly when the machine cycles power. > > I tried just naively sticking > > /usr/local/icecast/bin/icecast & > /usr/local/icecast/bin/liveice & > >

Rythmomachy is a member of GotoMy.com and is inviting you to join our new community site! Rythmomachy Says: WELCOM Join GotoMy.com

Thanks guys, this is exactly what I was looking for. Now, all I have to do is figure out how to start icecast and liveice cleanly when the machine cycles power. I tried just naively sticking /usr/local/icecast/bin/icecast & /usr/local/icecast/bin/liveice & into rc.local, but something weird happens. It just loops on a message 'you can run but you can't hide' over and over

Hi guys. I've been running icecast for awhile, and just upgraded to the latest version. Everything works fine, nice work. Here's the deal, I'm still not sure how to make a clean link to my broadcast. On the icecast.org site, it calls a cgi-bin file called 'gen-mpegurl.m3u.' This always stars up my broadcast nicely. Is there anyway to get the source code to

Hi Dave, ----- Mail original ----- > Changes since v1: [...] > diff --git a/drm/nouveau/nouveau_vga.c b/drm/nouveau/nouveau_vga.c > index 9a6328f..7b13804 100644 > --- a/drm/nouveau/nouveau_vga.c > +++ b/drm/nouveau/nouveau_vga.c > @@ -36,7 +36,7 @@ nouveau_switcheroo_set_state(struct pci_dev *pdev, > { > struct drm_device *dev = pci_get_drvdata(pdev); > > - if

On 12/03/2014 11:13 AM, Mark Milhollan wrote: <> > Do you mean PartedMagic as the destination port? If so that's just a > translation from the port number to a name found in your /etc/services > file. It is often wrong or misleading, and in most cases can be > ignored. i have no PartedMagic in /etc/services >> NetName: COMCAST-VOIP-4 > > Given this

Hi all, My client softphone supports IM feature. Does any warmheated expert know if Asterisk can support IM also at server side? If so, is there any related documents or weblinks? -- Thanks & Best Regards! Steven Li -------------- next part -------------- An HTML attachment was scrubbed... URL: http://lists.digium.com/pipermail/asterisk-users/attachments/20060409/f131bc17/attachment.htm

Hi All, I am not so expert on rsync. I am using windows XP and Vista. I am able to take the backup using rsync.(It does not give the incremental) I need to take incremental also. After some googling (referring the link- http://www.jeffawaddell.com/2008_04_01_archive.html) I found that rsync + ZFS snapshot does the same job. It use rsync to make delta backups to the file server, and automatic ZFS