similar to: (no subject)

Hey guys, can anyone help? i have a sample table: >table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11, 8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1", "gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2", "codon3"))) >table codon1 codon2 codon3 gene1 4.0 7

Hey guys, Can anyone help? I did a correspondance analysis and made a plot. I also have a specific list of nodes that i want to find in my plot and want to either color the nodes that appear in my list differently, or put some kind of border around that group of nodes... Would anyone know how to do this? Also, would this post be more relevant here or in the bioconductor forum? -- View this

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

I do have a bunch of genes ( nearly ~50000) from the whole genome, which read in genomic ranges A range(gene) can be seem as an observation has three columns chromosome, start and end, like that seqnames start end width strand gene1 chr1 1 5 5 + gene2 chr1 10 15 6 + gene3 chr1 12 17 6 + gene4 chr1 20 25 6 + gene5

I have 2 files containing data analysed by 2 different methods. I would like to find out which genes appear in both analyses. Can someone show me how to do this? _________________________________________________________________ [[trailing spam removed]] [[alternative HTML version deleted]]

Hello all! I have the following problem with the %in% command: 1) I have a data frame that consists of functions (rows) and genes (columns). The whole has been loaded with the "read.delim" command because of gene-duplications between the different rows. 2) Now, there is another data frame that contains all the genes (only the genes and without duplicates) from all the functions of

I do have a bunch of genes ( nearly ~50000) from the whole genome, which read in genomic ranges A range(gene) can be seem as an observation has three columns chromosome, start and end, like that seqnames start end width strand gene1 chr1 1 5 5 + gene2 chr1 10 15 6 + gene3 chr1 12 17 6 + gene4 chr1 20 25 6 + gene5

hi, folks: i need to transpose the following data: gene tissue patient1 patient2 patient3..... --------------------------------------------- gene1 breast 10 100 1 gene2 breast 20 200 4 gene3 breast 30 50 5 gene4 breast 40 400 9 ................................ to the

Hey guys, Does anyone have an example of a REALLY simple shell script in R. Basically i want to run this command: library(MASS) wilcox.test(list1,list2,paired=TRUE,alternative=c("greater"),correct=TRUE,exact=FALSE) in a shell script something like this: #!/bin/bash R library(MASS) for i in *.out do wilcox.test($i,${i/out}.out2,paired=TRUE) >> $i.out done that i can run on a

Hi Everyone, I am trying to find a way to do this in excel to tell me which genes are the most differentially expressed. Sorry, i couldn't find excel forum section in nabble. However, if it is in R it is fine. This is a microarray data, and it has been normalized. According to Dov Stekel in Microarray, i will need to calculate log ratio (control-treatment). Once you have the log ratio,

>Date: Thu, 6 Mar 2008 06:46:07 -0800 (PST) >From: Keizer_71 <christophe.lo@gmail.com> >Subject: [R] Statistical Questions: finding differentially expressed >genes >To: r-help@r-project.org >Message-ID: <15873163.post@talk.nabble.com> >Content-Type: text/plain; charset=us-ascii >Hi Everyone, >I am trying to find a way to do this in excel to tell me which

Hello, I'm a graduate student in Genetics, who has just started working with R. I have been trying to do a k-means clustering of an expression data compilation, which has lots of NA values in it. As suggested in a couple of earlier posts, I tried using na.omit() and the MICE imputation algorithm to take care of the NA, but they dont seem to work that well. na.omit() deletes the entries,

Hey guys, I'd really appreciate any help. I have a multivariate analysis done, the output of which is: > GraphData <-read.table("eigen.coa") > GraphData V1 V2 V3 V4 1 1 0.371970 0.8552 0.8552 2 2 0.061785 0.1420 0.9972 3 3 0.001211 0.0028 1.0000 4 4 0.000000 0.0000 1.0000 > summary(GraphData) V1 V2 V3

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

This is an automated email from the git hooks/post-receive script. arrfab pushed a commit to branch main in repository centos/centos.org. The following commit(s) were added to refs/heads/main by this push: new 078b3ae Fixed hour/link for infra sig meeting 078b3ae is described below commit 078b3ae229f5d8770bbc0fcfb079970c3def4551 Author: Fabian Arrotin <arrfab at centos.org>

SocketError in EmailController#correspond getaddrinfo: no address associated with hostname. Please see above, these are the errors i get when i try to email a user on my networking site. Can you help please. Actionmailer address = smtp.vodafone.ie Below is code used for the email controller in apps/controllers/email_controller.rb There doesnt seem to be any code missing. Can someone help with

Hi I would like to plot the variation of some mean values with time, and have the standard deviation around the mean shaded on the plot. I could not find a way to have the shaded area on the curve with the default R commands, do I need a special package to do that? Or any idea of a way with the default R commands? Many thanks Thomas -- Thomas Loridan King's College email: thomas.loridan

Hi, I''m using heatmap.2 to cluster my data, using the centroid method for clustering and the maximum method for calculating the distance matrix: library("gplots") library("RColorBrewer") test <- matrix(c(0.96, 0.07, 0.97, 0.98, 0.50, 0.28, 0.29, 0.77, 0.08, 0.96, 0.51, 0.51, 0.14, 0.19, 0.41, 0.51), ncol=4, byrow=TRUE)

Hello I have two lists of numbers, each list is ~800 numbers long. I want to know if the two lists are significantly different from each other. Could anyone suggest what library in R to use? I think maybe the mann-whitney test, as it is not parametric, but i am unsure if it is suitable as my list of items are so long.So i am unsure which library would suit best. Aaral. [[alternative HTML

Hi list, I have a question about using *read.table()* to read in a txt file. Basically, it consists of 16346 rows, 6 columns (no header). The code I used is: exprSet <- read.table('process_all4_GSA2.txt', row.names = 1,header =FALSE) and I got an error message: > exprSet <- read.table('process_all4_GSA2.txt', row.names = 1,header =FALSE) Error in