similar to: basic help: graph multivariate analysis.

Displaying 20 results from an estimated 100 matches similar to: "basic help: graph multivariate analysis."

2010 Nov 04
1
Best Fit line trouble with rsruby
Hello, I am using R, through rsruby, to create a graph and best fit line for a set of data points, regarding data collected in a Chemistry class. The problem is that although the graph functions perfectly properly, the best fit line will not work. I initially used code I pretty much copied from a website with a tutorial on this, which was: graphData.png("/code/Beer's-Law
2018 Apr 05
2
Obtain gradient at multiple values for exponetial decay model
Readers, Data set: t,c 0,100 40,78 80,59 120,38 160,25 200,21 240,16 280,12 320,10 360,9 400,7 graphdata<-read.csv('~/tmp/data.csv') graphmodeld<-lm(log(graphdata[,2])~graphdata[,1]) graphmodelp<-exp(predict(graphmodeld)) plot(graphdata[,2]~graphdata[,1]) lines(graphdata[,1],graphmodelp) Please what is the function and syntax to obtain gradient values for the model curve at
2007 Jul 10
6
Having trouble using data returned by Ajax.request
Hello everyone, I''m new here. I''ve been working with prototype and plotr for about a month now, off and on, and I have pretty much hit the wall on using the data returned by Ajax.Request. I''m using some php code to return a string: {''foo'': [[0,0.0865334429075127], [1,0.0828179861705063], [2,0.0828173042602942], [3,0.0841707718624196]]} But I keep
2008 Aug 14
1
Graphing: plot 3rd variable based on color gradient
Hello, I am searching for the best method to plot two variables with points whose output color depends on the size of a third variable. For example, the darkness of the x-y point would increase incrementally based on the size of the z value, similar to the colramp parameter in geneplotter. This would be analagous to symbols(), except changing the selection from the color gradient rather than the
2018 Apr 06
3
Obtain gradient at multiple values for exponential decay model
> On Apr 6, 2018, at 8:03 AM, David Winsemius <dwinsemius at comcast.net> wrote: > > >> On Apr 6, 2018, at 3:43 AM, g l <gnulinux at gmx.com> wrote: >> >>> Sent: Friday, April 06, 2018 at 5:55 AM >>> From: "David Winsemius" <dwinsemius at comcast.net> >>> >>> >>> Not correct. You already have
2018 Apr 07
0
Obtain gradient at multiple values for exponential decay model
I have never found the R symbolic differentiation helpful because my functions are typically quite complicated, but was prompted by Steve Ellison's suggestion to try it out in this case: ################# reprex (see reprex package) graphdta <- read.csv( text = "t,c 0,100 40,78 80,59 120,38 160,25 200,21 240,16 280,12 320,10 360,9 400,7 ", header = TRUE ) nd <- c( 100, 250,
2010 Apr 24
1
help please: predict error code
Hello,   I am trying to calculate predicted values derived from one dataset into a hypothetical dataset. I tried this line of code:   graphdata$fmgpredvalues <- predict(Acs250.3.4, graphdata)   and received the following error message:   ERROR: ZXend[1], drop = FALSE] %*%lmeFit$beta   I have made sure all variable names are the same between the two datasets and all factors are appropriately
2018 Apr 06
1
Obtain gradient at multiple values for exponential decay model
> Sent: Friday, April 06, 2018 at 1:44 PM > From: "Jeff Newmiller" <jdnewmil at dcn.davis.ca.us> > > You did not try my suggestion. You tried David's, which has a leftover mistake from your guesses about what the argument to coef should be. Yes, sorry for the mistake. coef(graphmodeld) (Intercept) graphdata[, 1] 4.513544204 -0.006820623 This corresponds
2018 Apr 05
0
Obtain gradient at multiple values for exponetial decay model
This smells like homework, which the Posting Guide indicates is off topic. I am not aware of "the function" that will solve this, but if you know what a gradient is analytically then you should be able to put together a solution very similar to the code you already have with the addition of using the coef function. -- Sent from my phone. Please excuse my brevity. On April 5, 2018
2012 Apr 25
3
R shell script
Hey guys, Does anyone have an example of a REALLY simple shell script in R. Basically i want to run this command: library(MASS) wilcox.test(list1,list2,paired=TRUE,alternative=c("greater"),correct=TRUE,exact=FALSE) in a shell script something like this: #!/bin/bash R library(MASS) for i in *.out do wilcox.test($i,${i/out}.out2,paired=TRUE) >> $i.out done that i can run on a
2012 Mar 16
1
plot columns
Hey guys, can anyone help? i have a sample table: >table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11, 8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1", "gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2", "codon3"))) >table codon1 codon2 codon3 gene1 4.0 7
2009 Feb 08
2
SocketError in EmailController#correspond
SocketError in EmailController#correspond getaddrinfo: no address associated with hostname. Please see above, these are the errors i get when i try to email a user on my networking site. Can you help please. Actionmailer address = smtp.vodafone.ie Below is code used for the email controller in apps/controllers/email_controller.rb There doesnt seem to be any code missing. Can someone help with
2018 Apr 06
0
Obtain gradient at multiple values for exponential decay model
> On Apr 6, 2018, at 3:43 AM, g l <gnulinux at gmx.com> wrote: > >> Sent: Friday, April 06, 2018 at 5:55 AM >> From: "David Winsemius" <dwinsemius at comcast.net> >> >> >> Not correct. You already have `predict`. It is capale of using the `newdata` values to do interpolation with the values of the coefficients in the model. See:
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >
2018 Apr 06
2
Obtain gradient at multiple values for exponential decay model
> Sent: Friday, April 06, 2018 at 5:55 AM > From: "David Winsemius" <dwinsemius at comcast.net> > > > Not correct. You already have `predict`. It is capale of using the `newdata` values to do interpolation with the values of the coefficients in the model. See: > > ?predict > The ? details did not mention interpolation explicity; thanks. > The
2009 Aug 13
3
Plotting shaded areas
Hi I would like to plot the variation of some mean values with time, and have the standard deviation around the mean shaded on the plot. I could not find a way to have the shaded area on the curve with the default R commands, do I need a special package to do that? Or any idea of a way with the default R commands? Many thanks Thomas -- Thomas Loridan King's College email: thomas.loridan
2012 Mar 07
2
find points on a graph
Hey guys, Can anyone help? I did a correspondance analysis and made a plot. I also have a specific list of nodes that i want to find in my plot and want to either color the nodes that appear in my list differently, or put some kind of border around that group of nodes... Would anyone know how to do this? Also, would this post be more relevant here or in the bioconductor forum? -- View this
2012 Mar 12
1
(no subject)
Hey guys, if i do a correspondance analysis, e.g.: table <- structure(c(4, 7, 0.2, 3, .1, 7, 222, 3, 10, 5, 11, 8, 8, 10, 7), .Dim = c(5L, 3L), .Dimnames = list(c("gene1", "gene2", "gene3", "gene4", "gene5"), c("codon1", "codon2", "codon3"))) Library(ca) plot(ca(table)) is there a way that i can see
2012 Apr 23
1
check for difference.
Hello I have two lists of numbers, each list is ~800 numbers long. I want to know if the two lists are significantly different from each other. Could anyone suggest what library in R to use? I think maybe the mann-whitney test, as it is not parametric, but i am unsure if it is suitable as my list of items are so long.So i am unsure which library would suit best. Aaral. [[alternative HTML
2018 Apr 06
2
Obtain gradient at multiple values for exponential decay model
> Sent: Friday, April 06, 2018 at 4:53 AM > From: "Jeff Newmiller" <jdnewmil at dcn.davis.ca.us> > To: "g l" <gnulinux at gmx.com> > coef( graphmodeld ) > coef(graphmodelp) Error: $ operator is invalid for atomic vectors A quick search engine query revealed primarily references to the dollar sign ($) operator which does not seem relevant to this