similar to: add data to a file while doing a loop

Dear all, I am using the R package SNPRelate but I found an error when I run the following command. Do you know what might be the problem? Thanks in advance. > vcf.fn <- system.file("extdata", "sequence.vcf", package="SNPRelate") > snpgdsVCF2GDS(vcf.fn, "test.gds") Start snpgdsVCF2GDS ... Open

Dear all, I would like to know how can I create a binned column in a data.frame. The output that I would like is something like this: Start Binned_Start 1 0-5 2 0-5 6 5-10 8 5-10 13 10-15 ... Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers

Dear all, I would like to know how can I retrieve a data.frame without the columns that have a partial match name. Let´s say that I have a data.frame with 200 columns and 100 of them have the name "StartX", with X being the unique part for each column name. I want to delete all columns that have the name starting with "Start". I´ve tried to do this but it doesn´t work: >

Dear all, Can I do a permutation test if the number of individuals in one group is much bigger than in the other group? I searched the literature but I didin´t find any assumption that refers to this subject for permutation tests. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O.

Dear all, I would like to take out the values from one vector that are equal to the values in another vector. Example: a <- c(1,2,3,4,5,6,7,8,9) b <- c(3,10,20,5,6) b_noRepeats = c(10,20) So I would like to have the vector b without the same values as vector a. Kind regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I concatenate 2 data.frames into a single one. Both data frames have the same number of columns and the same class type in each correspondent column. So what I want is to have a new data.frame where I have first the values from one data.frame and then the values from a second data.frame would came after in this new data.frame. Thanks in advance. Med

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how to subset a data.frame by rows. Example: Probesets 34884 34888 34892 1 100009676_at A A A 2 10001_at P P P 3 10002_at A A A 4 10003_at A A

Dear all, I would like to know how to merge columns like: Input file: V1 V2 V3 V4 V5 V6 1 G A G G G G 2 A A G A A G Desired output file: V1 V2 V3 1 G/A G/G G/G 2 A/A G/A A/G So for every 2 consecutive columns merge their content into one. Thanks in advance. [[alternative HTML version deleted]]

Dear all, I would like to be able to subset a data.frame in a special way. I will put here an example: Score Name 88 000019_0070 88 000019_0070 87 000019_0070 79 002127_0658 79 002127_0658 77 002127_0658 So, for the above example I would like to have a new data.frame that has only the best "Score" for each

Dear all, I would like to be able to know the intervals of my data that overlap between them. Here it goes a small example: Input: Start End 440 443 380 443 290 468 Desired output: Start End 290 380 380 440 440 468 Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I read a text file and create a data frame of only certain parts of the file. For instance, from this text file: =================================================== Matches For Query 0 (108 bases): 000019_0070 =================================================== Score Q_Name S_Name Q_Start Q_End S_Start S_End Direction Bases identity 89 000019_0070

Dear all, I would like to know how can I order a data.frame with increasing the dat$Interval (dat$Interval is a factor). There is an example below. Original data.frame: > dat Interval Number_reads 0-100 685 200-300 744 100-200 1082

Hi all, I'm trying to download a file from the net, and the download.file command leaves it corrupted, i.e excel cannot open it. It seems as if it's going ok, however. Does anyone have an idea of what's going on? regards, Gustaf Rydevik ---- >download.file(url="http://www.who.int/entity/whosis/whostat2006_demographics.xls",destfile="whodem.xls") trying URL

Dear all, I would like to generate 25 numbers from 1 to 100 but I would like to have some numbers that could be more probable to come out. I was thinking of the function runif: runif(25, 1, 100) , but I don?t know how to give more weight to some numbers. Example: each number from 2 to 10 has the probability of 40% to come out but the probability of each number from 11 to 100 to come out is

Full_Name: Gustaf Rydevik Version: 2.7.1 OS: Win XP professional Submission from: (NULL) (130.237.97.254) The following lines of code crash R 2.7.1 (=cause R to show "The R gui has encountered a problem and needs to close"....). Replicated on two WinXp professional machines, as well as by Uwe Ligges. > sessionInfo() R version 2.7.1 (2008-06-23) i386-pc-mingw32 locale:

Hi! I'm wondering if there's a smart way around this: fileName= (some valid file on your system) > fileCon=file(fileName, open="rt") > l<-readLines (fileCon, n= 1) > > isOpen(fileCon) [1] TRUE > close(fileCon) > isOpen(fileCon) Error in isOpen(fileCon) : invalid connection How do you test for a file being closed if isOpen gives you an error

Hi, The added support for semi-transparent colours in `windows' under R-2.6.0 for Windows is much appreciated. However, I've discovered that issuing a `layout' (or `par' with arguments `mfcol'/`mfrow') call and then trying to plot several figures with semi-transparent colour on the same page results in only the first one being fully drawn. E.g. > x <-

Dear all, I would like to know if I can compare by a significance test 2 models with different kind of parameters. Perhaps I am wrong but I think that we can only compare 2 models if one is a sub model of the other. Med venlig hilsen / Regards João Fadista Ph.d. studerende / Ph.d. student AARHUS UNIVERSITET / UNIVERSITY OF AARHUS Det Jordbrugsvidenskabelige Fakultet / Faculty of

Hi everyone, I'm an R newbie working with the poLCA module. I achieved my target without having to bother anyone, but It seems that I've got stuck at the last minute. My problem is simple. I need to write my results into a file. My results are in the shape of a list (unbalanced columns) I've considered several methods (sink(), write.file) etc. etc. Unfortunately, I'm not the best