similar to: Should %U work in include statements?

Displaying 20 results from an estimated 600 matches similar to: "Should %U work in include statements?"

2002 Feb 21
3
Any way to prevent mapped drives?
Is there any way to prevent users from mapping drive letters to Samba shares? We are constantly getting user problems like: "I can't find my files on my F: drive. Please restore it". They expect us to know where their F: drive was mapped. We try to show users how to use UNCs and shortcuts, but I would like to prevent mapped drives. There is another reason to prevent them:
2007 Oct 19
2
AD Auth, but Unix users and groups
Hello All: I have a Samba server (running 3.0.11) that uses an LDAP SAM for authentication. We now have AD (native mode) running in house. Since everyone has a login there, I would like to use the AD credentials for authentication. However, I would like to continue to use the Unix user ids and group ids, etc. All the documentation for AD authentication talks about ID mapping, etc. I don't
2002 Jan 14
3
smbpasswd file NFS sharable?
If I want to make two servers use the same encrypted passwords can I share the smbpasswd file via NFS? Will updates/locking work correctly? Is there an alternative? Can LDAP/PAM use encrypted passwords? -- Gary Algier, WB2FWZ gaa@@ulticom.com +1 856 787 2758 Ulticom Inc., 1020 Briggs Rd, Mt. Laurel, NJ 08054 Fax:+1 856 866 2033 A self-addressed envelope
2003 Apr 08
1
Can't do Landscape with ManualFeed
Hi: I am haviong problems with Landscape mode on our HP printers (many models). I am running 2.2.7a on two different servers. One is using the "old style" printing (using "printer driver file" parameter). The other is using the newer printing system. It is the same code on both. Both are Solaris systems. For the old one, the drivers are installed on the client, for the
2002 Mar 26
4
Can't print duplex
I am trying to switch over to the new "style" of printing, but when I do, I loose the ability to print duplex. I have two servers. The old one (spike) is setup as a file server, etc. and the print services date back to the early 2.0 days. It is currently running 2.2.2 with the original printer setup. The printing works ok with this server. People can print using features of the
2002 Dec 04
2
Won't %L work anymore?
I am trying to run multiple instances of samba on the same unix host. This is being done so that I can functionally breakdown the usage into, for example, a "finance" server and an "engineering" server. This is not based upon the client or the user, but based upon the virtual server. My first attempts were a real problem in that, though the config file could be specified on
2004 Dec 08
3
Samba printer name != cups printer name
I recently added a printer to cups and the samba name is wrong. Anyone know how I can fix it? Environment: OS: Red Hat Enterprise Linux ES release 3 (Taroon Update 3) Uname: Linux stilton.ulticom.com 2.4.21-20.EL #1 Wed Aug 18 20:58:25 EDT 2004 i686 i686 i386 GNU/Linux Samba: samba-client-3.0.4-6.3E samba-common-3.0.4-6.3E samba-3.0.4-6.3E Cups: cups-libs-1.1.17-13.3.16
2004 Apr 22
0
Auto driver download, only sometimes
Hello, I am running Samba 3.0.2 with Cups support. Recently I set this up on a new server, shut down the old Samba 2.* server, changed the name and brought up the new server as our new print server. Everyone automatically had all their drivers "upgraded", even when they previously had special local drivers installed. They did not need to delete and re-double-click the printer icon on
2004 Jul 21
0
pam_smbpass: Cannot access samba password database
I think pam_smbpass it is not initializing all the parameters from smb.conf. This exhibits itself as "Cannot access samba password database" messages in the syslog. I ran my test code using "truss" and there are some interesting open() calls: --------------------------------------------------------------------- 20247: open64("/secrets.tdb", O_RDWR|O_CREAT, 0600)
2004 Aug 25
0
Time warp?
Why do I seem to have an internal time warp: root@gouda 18% net time ; date Wed Aug 25 11:36:52 2004 Wed Aug 25 11:31:21 EDT 2004 root@gouda 19% -- Gary Algier, WB2FWZ gaa at ulticom.com +1 856 787 2758 Ulticom Inc., 1020 Briggs Rd, Mt. Laurel, NJ 08054 Fax:+1 856 866 2033 Nielsen's First Law of Computer Manuals: People don't read documentation
2004 Jul 07
1
Domains: Pros and Cons?
I have Samba running without a PDC and I have some questions about the advantages for implementing one with Samba vs. the problems and disadvantages. Perhaps some kind souls can help me determine whether I should do this or not. We have three offices connected by a Checkpoint VPN, plus people "on the road" using their SecureClient tool. We want everyone to be able to get to all the
2001 Nov 29
0
Disappearing shares
I have a problem of shares that "disappear" or are inaccessible. This only happens with Win2k and only for some users. My Samba is version 2.2.2 running on Solaris 2.6. Here's the sequence: 1) The user logs into PC (not using PDC). 2) He connects to Samba server via "Run..." and typing \\spike. 3) The user is prompted for "connect as" and "password".
2000 Aug 28
0
samba digest, Vol 1 #12 - 20 msgs
Onno Zweers <onno@verweij.com> wrote: > Message: 17 > Date: Mon, 28 Aug 2000 16:49:39 +0200 > To: samba@samba.org > From: Onno Zweers <onno@verweij.com> > Subject: Making a share visible only to members of a group > > Hi all (and hopefully also someone of the samba team), > > I want a shared directory to be visible only to the members of a group, and >
2001 Nov 30
0
security = domain does not work
I can't get "security = domain" to work. Environment: Samba 2.2.2 on Solaris 2.6 and 8 I have a Samba PDC setup. I can get my Win2k desktops to login and access the PDC just fine. I setup another Samba on our Unix print server that I wan't to use "security = domain". It seems to be running in "security = user" mode. I did the "smbpasswd -j mtlaurel
2002 Feb 21
2
RH 7.1 and Ctrl+Alt+Del [off topic]
I know this isn't samba problem, but I hope that You'll understand. I have RH 7.1 installed (Kernel 2.4.2-2) and I have strange, funny but really dangerous problem. In every moment (even when there is login screen) in text mode when I press Ctrl+Alt+Del my machine simply shuts down. Is there any fix for this? PZDRWM Szmoyn
2001 Dec 27
0
Samba PDC _and_ Samba member?
I am trying to get a Samba PDC and a Samba member server to work together. I can't. The documentation describes how to make a Samba PDC work. I got that working. My Win2k desktop can join just fine. The documentation describes how to make a Samba server be a member of an NT domain. It does not tell how to make Samba trust Samba. That's my problem. I have the PDC setup to
2008 Nov 14
1
Bug#505698: r-base-core: dev2bitmap fails with gsexe related error (PR#13288)
Stefano, Thanks for the bug report. On 14 November 2008 at 14:35, Stefano Costa wrote: | Package: r-base-core | Version: 2.8.0-1 | Severity: normal | | As in subject. The bug is reproducible on my machine with these | commands: | | > x <- rnorm(100) | > plot(density(x)) | > dev2bitmap("density.png") | Error in paste(shQuote(gsexe), " -dNOPAUSE -dBATCH -q
2008 Nov 03
1
dev2bitmap: extra missing
Hi, I don't know if I am the first one to report the problem: in 2.8.0 dev2bitmap gained aa support, but "extra" is null if neither taa nor naa is specified. > dev2bitmap("plot.pdf",type="pdfwrite") Error in paste(shQuote(gsexe), " -dNOPAUSE -dBATCH -q -sDEVICE=", type, : object "extra" not found >
2000 Aug 18
1
Samba vs Solaris PC-Netlink
Does anyone have any idea how Solaris PC-Netlink compares to Samba? It seems to support ACLs (does Samba?) Also, how do they both do on the subject of being a domain controller? What I am looking for is ACL support (I am getting tired of making every possible combination of groups to deal with user needs). I also want LDAP support whereby changing the passwd from an NT system changes both the
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >