similar to: intermittent segfault upon invocation

A question for the WineLib guru's :) I am using the wine-20011108 build with Mandrake 8.0 and with this version of wine clean compiled and installed I can run several windows programs very successfully :). Then I use winemaker to create a WineLib 'so' file and the compile and link again runs clean. But when I run the resulting 'so' file using this command line: $

Hi, I was using wine_0.0.20040309-1 in a Debian distro and it was working. I updated to wine_0.0.20040408-1, it is not working more. The bug report is below. Note that if I go to directory where .exe file is and starts wine. Wine works. I think that the problem is with blank spaces in the directory name. Bug report: Warning: the --debugmsg option is deprecated. You should use the WINEDEBUG

On 04/05/15 04:02, Carl Gherardi wrote: > Hi all, > > I'm using Ubuntu 14.04 samba 4.1.6 packages, attempting to set up a server > for file shares AD clients can use. My previous setup was a simple AD join > with a user map file (1 to 1 AD to unix user) that i've been migrating for > approximately 7 years, and with the last 2003 AD server removed from the > network it

Hi all, I'm using Ubuntu 14.04 samba 4.1.6 packages, attempting to set up a server for file shares AD clients can use. My previous setup was a simple AD join with a user map file (1 to 1 AD to unix user) that i've been migrating for approximately 7 years, and with the last 2003 AD server removed from the network it stopped working (2008 R2 DC's now). After approximately 2 weeks of

2015-05-04 13:01 GMT+02:00 Rowland Penny <rowlandpenny at googlemail.com>: > On 04/05/15 04:02, Carl Gherardi wrote: > >> Hi all, >> >> I'm using Ubuntu 14.04 samba 4.1.6 packages, attempting to set up a server >> for file shares AD clients can use. My previous setup was a simple AD join >> with a user map file (1 to 1 AD to unix user) that i've

Hello, I have been having problems installing the Login Engine. I follow all the steps found on the download site (rails-engines.org), but when I get to the DB_SCHEMA step, I do rake engine_migrate ENGINE=login in the application root. """ C:\rails\cag> rake engine_migrate ENGINE=login (in C:/rails/cag) rake aborted! Don''t know how to build task

Dear all, I wrote the following batch script on a iMac, and ran it on a linux mosix cluster. tu <- read.table("cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshape.table") tu_reshaped <- t(reshape(tu[1:50,], direction="wide", timevar="tu", idvar=c("rna","lib"))) write.table(tu_reshaped, "cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshaped.table")

Hi, i try to install the demo version of "battle for middle earth II" with wine-0.9.26, but without success so far... 'WINEDEBUG=+all wine nzd_bfme2demo_english_final.exe' gives a rather short log (172ko) but probably too large to be sent to the list. A snipet of the very end of the log says : 0009:trace:nls:WideCharToMultiByte cp 0 L"Invalid parameter\n\0000" ->

Hi, I have done a lot of work to try to get it to run, but now I am stuck. Following are the things I've tried. Money 97 will install (after a long time) on both Crossover Office 2.1.0 and wine-20040121. When starting the program in both Crossover and wine, an error dialog box is displayed when starting the program. The text of the error message is: "The path is not properly set up

Hello, A newbie to R. I am trying to use the exonmap package in R. According to the docs, the xmapDatabase() command should read the config file with all the connection parameters and connect to the DB. But i get the error shown below.... > xmapDatabase("Human") Error in mysqlNewConnection(dbDriver(drv), ...) : RS-DBI driver: (could not connect cagadmin at mysql2.cag.chop.edu on

I am using wine actually only to play WoW on Gentoo Linux. On my desktop PC that works, but on my laptop the program crashes. This appears to be a fault in wine, because I cannot even use winecfg - it segfaults immediately: Code: $ winecfg wine: created the configuration directory '/home/helge/.wine' err:process:__wine_kernel_init boot event wait timed out Segmentation fault I tried

http://bugzilla.mindrot.org/show_bug.cgi?id=138 patl at cag.lcs.mit.edu changed: What |Removed |Added ---------------------------------------------------------------------------- Status|RESOLVED |REOPENED Resolution|FIXED | ------- Additional Comments From patl at cag.lcs.mit.edu 2002-05-13 00:55

Hi. Background - I am working with a dataset involving around 750K observations, where many of the variables (8/11) are unordered factors. The typical model used to model this relationship in the literature has been a simple linear additive model, but this is rejected out of hand by the data. I was asked to model this via kernel methods, but first wanted to play with the parametric

Hi, the Wine-20030408 installation on my system appears to crash directly after starting. A few weeks ago this happend only sporadically. But now WINE don't run at all. A --debugmsg +all delivers the following: --------------------------------------------------------------------- 0009:trace:heap:RtlSizeHeap (0x40360000,00000002,40360098): returning 00000968

http://defect.opensolaris.org/bz/show_bug.cgi?id=971 Summary: zfs key -l fails after unloading (keyscope=dataset) Classification: Development Product: zfs-crypto Version: unspecified Platform: Other OS/Version: Solaris Status: NEW Severity: major Priority: P2 Component: other AssignedTo:

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

http://bugzilla.mindrot.org/show_bug.cgi?id=177 Summary: chroot tools for OpenSSH 3.1p1 Product: Portable OpenSSH Version: -current Platform: Other URL: http://cag.lcs.mit.edu/~raoul/. OS/Version: other Status: NEW Severity: enhancement Priority: P3 Component: sshd AssignedTo:

Dear James and Chris, I would like to buid openssh with the chroot patch. I applied the http://cag.lcs.mit.edu/~raoul chroot patch to openssh-3.1p1, configured it using a simple "--with-chroot" for testing and compiled under Mandrake 8.2. Problem : 1) Configuration report shows no chroot configuration. What is wrong? 2) After compiling, I added a test user with

http://defect.opensolaris.org/bz/show_bug.cgi?id=2057 Summary: zpool key -u - permission denied should be clear Classification: Development Product: zfs-crypto Version: unspecified Platform: Other OS/Version: Solaris Status: NEW Severity: minor Priority: P3 Component: other AssignedTo: ajscarp

hi all, since about 3 weeks i'm having trouble running cvs wine (no problems before). on startup it says: kde3@lisi [~] $ wine Warning: no valid DOS drive found, check your configuration file. Warning: could not find wine config [Drive x] entry for current working directory /home/kde3; starting in windows directory. Invalid path L"c:\\windows" for L"windows"