similar to: Continued utmp probs with sshlogin.c

Hi, I've got a 2.8-RELEASE box that uses the old utmp.h with: #define UT_NAMESIZE 8 #define UT_LINESIZE 8 #define UT_HOSTSIZE 16 2.5.1's ssh/login.c seems use this by including <utmp.h>. However, when a remote user logs into this box, the wtmp file is munged from that point on. There are no notes about this on the OpenSSH site ("OpenSSH compiles cleanly

Hi All, I'm seeing tapdisk processes not being terminated after a HVM vm is shutdown or migrated away. I don't see this problem with linux paravirt domu's, just windows hvm ones. xl.cfg: name = 'nathanwin' memory = 4096 vcpus = 2 disk = [ 'file:/mnt/gtc_disk_p1/nathanwin/drive_c,hda,w' ] vif = [ 'mac=00:16:3D:01:03:E0,bridge=vlan208' ] builder =

Hello, I am trying to walk through the following document: http://homepages.lu/charlesschwartz/radius/freeRadius_AD_tutorial.pdf in order to authenticate Cisco router and switch logins against FreeRadius/Active Directory. Using the HowTo, I have successfully joined a FC2 box to our Windows 2003 AD for testing purposes. I have also successfully used the manual ntlm_auth command to authenticate

On Tue, 20 Dec 2016 13:50:40 +0000 Brian Candler via samba <samba at lists.samba.org> wrote: > Rowland Perry wrote: > > >/imdap config AD : backend = rid /> >/ > /> How did you 'fix' > > >this, on face value, there is nothing wrong with that line. > > > "imdap" is not "idmap" > > (so now you understand why I

Hi, We are planning to integrate CISCO-ISE with Samba-AD (Version 4.6.5). Websense gateway / proxy are all properly integrated and even single sign-on is properly functioning. However, before attempting integration of Cisco ISE with Samba-AD, through I should clarify on the following. Hence writing this mail. Cisco ISE supports LDAPs with Following authentication methods: * Extensible

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

On 20/12/2016 14:10, Rowland Penny wrote: >> I can't use rlm_krb5, because I plan to use PEAP+MSCHAP for wifi >> authentication. The krb5 module requires a cleartext password, but >> MSCHAP does not pass a cleartext password. (It is possible to use >> krb5 authentication with TTLS+PAP or TTLS+GTC, both of which send a >> cleartext password) > You might want to

Hi all, I am interested in calculating and displaying the distributions of pairwise comparisons between DNA sequences in populations. The comparisons are the number of nucleotide sites that differ between the two sequences (mismatches). My sequences are stored in a vector of strings. There is an additional vector of the same length that provides the indices to the DNA sequences. Finally, I

Rowland Perry wrote: > >/imdap config AD : backend = rid /> >/ > /> How did you 'fix' this, on face value, there is nothing wrong with that line. "imdap" is not "idmap" (so now you understand why I missed it after staring at it so long :-) > When you join the domain with 'kerberos method = secrets and keytab', > you should get a

Hi All, I've been poking around various parts of the auth code for a while. Some platforms support failed login counters and it occurs to me that there's as few too many instances of: #ifdef [PLATFORM] if (authenticated == 0 && strcmp(method, "password") == 0) some_login_failure_func(); #endif The attached patch creates a record_failed_login() function in

At work after updating to R 2.5 I get an error using epitab from package epitools, when at home (R 2.4) I get no error. Could someone help me? Thanks Pietro Bulian Servizio di Onco-Ematologia Clinico-Sperimentale I.R.C.C.S. Centro di Riferimento Oncologico Via Franco Gallini 2 33081 Aviano (PN) - Italy phone: +39 0434 659 412 fax: +39 0434 659 409 e-mail: pbulian at cro.it (at work)

Set up NIS and autofs on this new CentOS6 box, but it seems tilde expansion no longer works in bash? [root at frodo ~]# cd ~john -bash: cd: ~john: No such file or directory [root at frodo ~]# cd /home/john [root at frodo john]# pwd /home/john [root at frodo john]# It still works in t/csh: [root at frodo ~]# /bin/csh [root at frodo ~]# cd ~john [root at frodo ~john]# pwd /home/john [root at

It's not very high priority I'm afraid. Did you try using sqlite instead? Aki > On 13/12/2019 17:40 Aragon Gouveia <aragon at phat.za.net> wrote: > > > Hi Aki, > > I'm not sure if this bug was worked on?? Sadly I ran into it too > recently, on version 2.3.4.1. > > > Regards, > > Aragon > > > > On 2018/02/07 13:23, Aki

Dear R folks, We completed a matched case-control study that was analyzed using conditional logistic regression. Because of the small sample size we need to calculate exact confidence intervals. The quick solution is to purchase LogExact by Cytel. However, we'd like to do this in R. Anyone have experience with this? Many thanks, Tomas ____________________________________ Tomas Aragon, MD,

hi, i noted the following strange behaviour using ssh and linux. this is probably a low-priority bug: # ssh -V OpenSSH_3.6.1p2, SSH protocols 1.5/2.0, OpenSSL 0x0090701f # uname -a Linux funnyfarm 2.4.21-20.1.2024.2.1.nptl #1 Fri Jul 11 06:04:52 EDT 2003 i686 i686 i386 GNU/Linux # echo Hello | ssh frodo 'cat' Hello # echo Hello | ssh frodo 'cat /proc/self/fd/0' cat:

On 13/05/16 13:34, Tom Yates wrote: > I have built 4.4.3 on CentOS 6, with a fairly minimalist smb.conf, > provisioned the domain as per the wiki [1], and cannot get past test one: > > [root at frodo ~]# smbclient -L localhost -U% > Domain=[ADTEST] OS=[Windows 6.1] Server=[Samba 4.4.3] > tree connect failed: NT_STATUS_CONNECTION_DISCONNECTED > > I can get output if I

I have built 4.4.3 on CentOS 6, with a fairly minimalist smb.conf, provisioned the domain as per the wiki [1], and cannot get past test one: [root at frodo ~]# smbclient -L localhost -U% Domain=[ADTEST] OS=[Windows 6.1] Server=[Samba 4.4.3] tree connect failed: NT_STATUS_CONNECTION_DISCONNECTED I can get output if I specify a username, and give a password, but anonymous access seems to be

Hello I need help on a fedora release 11 (Leonidas) when I start the dovecot process I get an error : Jun 17 10:15:24 aragon dovecot: Dovecot v1.2.rc3 starting up (core dumps disabled) Jun 17 10:15:24 aragon dovecot: Fatal: auth(default): Support not compiled in for passdb driver 'ldap' Jun 17 10:15:24 aragon dovecot: Fatal: Auth process died too early - shutting down I installed

Hello list friends, I got the following error during yum update. How should I proceed to eliminate the probelm? (I thought perhaps to uninstall the .i386 package -- but there are some 15-20 other packages depending on it...) Repositories: dries, kbs-CentOS-Extras, update, rpmforge, base, addons, extras FWIW: the protectbase plugin was added on 2006-07-10. Thanks in advance, Itay

Hi All I am a newbie to Linux and Samba but getting thru it slowly and successfully.I am trying to get the Linux server accesible from windows and I need to know what the EXACT naming convention is for the LDAP settings in Samba. Here is the scenario I have a MS Active Directory in place with a W2003 server acting as a PDC emulator.The server is called Frodo and the domain is lab.co.za. I