Displaying 20 results from an estimated 1000 matches similar to: "Some moved or copied messages get stuck in tmp"
2006 Apr 28
5
Maildir + NFS + multiple machines = spectacular failure
I'm running beta7 on two machines, with maildir on NFS. I have lockd
running on all machines. I've found that Dovecot is highly unstable with
NFS when accessing a mailbox on more than one machine at the same time.
Both dovecot machines have:
mmap_disable = yes
lock_method = fcntl
NFS is version 3, exported from a third linux machine. All machines are
running 2.6.9 kernel.
Any ideas
2006 Aug 04
1
Dovecot proxy in front of UWash?
Is it possible to use Dovecot frontends in front of UWash backends?
I need a proxy pool ASAP. There is not sufficient time to migrate the
backends for 40,000+ users so they have to stay UW for now.
I have been looking at Perdition but concerned about performance under
load. Dovecot looks really promising with it's non-forking mode. I need
simple dumb frontends no local mail.
Other
2006 May 11
2
comment on dovecot documentation on PAM
Dear Dovecote devotees,
I have been going through dovecot configuration for the
first time. I am not an experienced systems administrator
so I had to do a left turn to read up about PAM while
doing all the configuration for my new webmail service.
I found that the writing in the dovecot documentation about
PAM to be rather misleading in at least one aspect.
The documentation I am specifically
2006 Apr 08
3
LDAP authentication via PAM
I've configured dovecot to authenticate against a Fedora Directory
Server. The mail server on which dovecot is installed has the
nss_ldap and pam_ldap packages installed, and /etc/dovecot.conf has the
following two lines:
auth_userdb = ldap /etc/dovecot-ldap.conf
auth_passdb = pam
In other words, I want dovecot to use LDAP to access the user database,
but PAM for authentication. This part is
2010 Oct 18
1
Imap Logout format
He all,
I'm migrating a big system from Courier to Dovecot and we have a
custom analyzer logger system to Courier logs.
We have got the very similar specs on IMAP LOGIN log, but I can't get
the Logout format.
Courier write like that:
... imapd: LOGOUT, user=luism.martinez, ip=[::ffff:127.0.0.1],
headers=0, body=0, rcvd=131, sent=632, time=0
?Is there any Variables on
2006 Jul 25
0
seqinr updated : release 1.0-5
Dear R users,
seqinR 1.0-5 has been released yesterday on CRAN, so that the source code
of the package should be available on all CRAN mirrors within the next 24h.
The updated package vignette is here:
http://pbil.univ-lyon1.fr/software/SeqinR/seqinr_1_0-5.pdf
User level visible changes are:
o A new function dotPlot() is now available.
2006 Jul 25
0
seqinr updated : release 1.0-5
Dear R users,
seqinR 1.0-5 has been released yesterday on CRAN, so that the source code
of the package should be available on all CRAN mirrors within the next 24h.
The updated package vignette is here:
http://pbil.univ-lyon1.fr/software/SeqinR/seqinr_1_0-5.pdf
User level visible changes are:
o A new function dotPlot() is now available.
2010 Jul 07
1
Director service for LMTP in 2.0rc1
Hello,
has anyone a running setup for LMTP proxy and the director service ?
pop3/imap/managesieve is properly working, but i have problems with
LMTP. I set it up as described in the conf.d/10-director.conf
From the user_db i get proxy=y and no proxyhost as described for imap/pop3
But lmtp is complaining about the missing host:
Jul 07 15:00:48 auth: Debug: master in: PASS 1
user56
2005 Apr 26
2
writing a data frame in excel format
Hello
I know how read a file in excel format into a R data frame using the
RODBC library, but I don't know how write a R data frame in excel
format. I don't understand the instructions from RODBC user manual.
To read an excel file I use.
library(RODBC);
conex<-odbcConnectExcel("fis_quim.xls");
sqlTables(conex);
data<-sqlFetch(conex,"hoja1");
Suppose I
2000 Oct 11
1
Bug? (PR#690)
I don´t know if it is a bug, but what's wrong in the folloing (R version
1.1.1, August 15, 2000, under windows 98):
> x<-matrix(nrow=10, ncol=2)
> for (i in 1:10)
+ {
+ x[i][1]<-i
+ x[i][2]<-i^2
+ }
Warning messages:
1: number of items to replace is not a multiple of replacement length
2: number of items to replace is not a multiple of replacement length
3: number of items to
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2006 Feb 14
2
Installing packages without clicking
I need to install several (too many) packages from local *.zip
files.
is there any form to do it without clicking?
I'm asking for a R code that allow me perform these task.
-----------------------------------
Mario Alfonso Morales Rivera.
Profesor Asistente.
Departamento de Matem??ticas y estad??stica.
Universidad de C??rdoba.
2012 Apr 24
1
Reading Mutt mboxes from Thunderbird
Hi, I'm a user of Mutt, and before moving to Thunderbird I'm trying to
share mboxes between them. To do this, I installed Dovecot to create an
IMAP server in my local machine, to serve mutt mboxes to be read by
Thunderbird.
So far, I can read my inbox from /var/mail/%u, but in mutt, I have many
folders in ~/mail, like 2010-mails, 2011-mails, mailing-list-x,
mailing-list-y, and so on. How
2014 Sep 08
3
problema con los cambios de marcas temporales en el eje X
Muchísimas gracias Carlos, de verdad que te agradezco la ayuda, pero no es lo que voy buscando. Quiero colocar en el eje de abscisas la secuencia temporal de los meses, es decir, agosto septiembre, octubre, etc? pero no las fechas de las toma de datos, sino que aparezca la marca de un mes, y la siguiente marca sea la del siguiente mes, etc?, y además que las muestras estén separadas de acuerdo con
2006 Feb 16
0
OK.rb''s First Meeting
James Edward Gray II and myself will be leading the first meeting of the
Oklahoma Ruby Users Group (OK.rb) on March 14th at 7 PM. The meeting will take
place in room 104 in the Nigh University Center (student center) on the campus
of the University of Central Oklahoma (UCO).
The first meeting will cover both Ruby and Ruby on Rails and will be aimed at
all skill levels. James will be giving a
2000 Jun 23
1
*.texi file
Dear Prof Ripley an d the R core team:
I have installed the new RW1010. But I can't see (in
RW1010\doc\manual ) the file R-intro.texi
I'd like to know if I have done something wrong.
Thank you,
Juan Antonio
--
===========================================
J.A.Caballero M.
Dpto. Estadistica e Investigacion Operativa
Campus de Rabanales
Edificio C-II
Universidad de Cordoba
14080 SPAIN
2005 Nov 07
1
*URGENTE* Sigo sin poder hacer funcionar WINE!!!
Hola a todos!!!!
Tengo un grave problema:
Sigo sin poder hacer funcionar WINE, he instalado desde la ultima version
(0.9), hasta la 2004-05-05, solo me ha funcionado ?sta ultima anteriormente
mencionada, no he probado versiones m?s viejas.
El sistema donde lo estoy intentando hacer funcionar es un Fedora Core 3
K12-LTSP con Kernel 2.6.11-1.14_FC3 en un tipo de maquina i686, que es una
IBM
2014 Sep 08
3
problema con los cambios de marcas temporales en el eje X
Hola de nuevo, acabo de encontrar la solución. He creado una variable ficticia con los días 1 de cada mes en la secuencia temporal que quería y después he actuado de la siguiente manera
attach(Libro1)
plot (xbar~as.Date(fecha,"%d/%m/%y"), type="b", pch=19,cex=2,xaxt="n")
xlabels<-strptime(ofeje, format = "%d/%m/%y")
axis.Date(1,
2014 Sep 08
2
problema con los cambios de marcas temporales en el eje X
Muchas gracias Carlos, previo a mi correo, entre las pruebas que hice estaba una parecida a la que apuntas de la siguiente manera:
attach (Libro1)
plot (xbar~as.Date(fechas,"%d/%m/%y"), ylim=c(400,660), xaxt="n", type="b", pch=19,cex=1)
xlabels<-strptime(fecha,format="%d/%m/%Y")
axis.Date (1,at=xlabels,format="%b-%y")
2010 Feb 26
3
dovecot 2.0b3 crash with lmtp and DNS based proxy
Hello,
i am trying to proxy a LMTP connection with version 2.0b3
Currently i have the problem when trying to use a named based proxy for
LMTP the process doesn't resolve the hostname and crashes:
Feb 26 16:53:26 auth: Debug: ldap(vodafonemail56 at vodafone.de,::1): pass
search: base=ou=mailboxes,ou=vfag,c=de,o=vodafone scope=subtree
filter=(&(objectClass=uco)(mail=vodafonemail56 at