similar to: subsetting by rows

Hi, I would like to know how can I keep adding data to a file while doing a loop and without deleting the data of the previous iteration. Thanks.

Dear all, I would like to know how can I create a binned column in a data.frame. The output that I would like is something like this: Start Binned_Start 1 0-5 2 0-5 6 5-10 8 5-10 13 10-15 ... Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers

Dear all, I would like to know how can I retrieve a data.frame without the columns that have a partial match name. Let´s say that I have a data.frame with 200 columns and 100 of them have the name "StartX", with X being the unique part for each column name. I want to delete all columns that have the name starting with "Start". I´ve tried to do this but it doesn´t work: >

Dear all, Can I do a permutation test if the number of individuals in one group is much bigger than in the other group? I searched the literature but I didin´t find any assumption that refers to this subject for permutation tests. Best regards João Fadista Ph.d. student UNIVERSITY OF AARHUS Faculty of Agricultural Sciences Dept. of Genetics and Biotechnology Blichers Allé 20, P.O.

Dear all, I would like to take out the values from one vector that are equal to the values in another vector. Example: a <- c(1,2,3,4,5,6,7,8,9) b <- c(3,10,20,5,6) b_noRepeats = c(10,20) So I would like to have the vector b without the same values as vector a. Kind regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I concatenate 2 data.frames into a single one. Both data frames have the same number of columns and the same class type in each correspondent column. So what I want is to have a new data.frame where I have first the values from one data.frame and then the values from a second data.frame would came after in this new data.frame. Thanks in advance. Med

Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how to merge columns like: Input file: V1 V2 V3 V4 V5 V6 1 G A G G G G 2 A A G A A G Desired output file: V1 V2 V3 1 G/A G/G G/G 2 A/A G/A A/G So for every 2 consecutive columns merge their content into one. Thanks in advance. [[alternative HTML version deleted]]

Dear all, I would like to be able to subset a data.frame in a special way. I will put here an example: Score Name 88 000019_0070 88 000019_0070 87 000019_0070 79 002127_0658 79 002127_0658 77 002127_0658 So, for the above example I would like to have a new data.frame that has only the best "Score" for each

Dear all, I am using the R package SNPRelate but I found an error when I run the following command. Do you know what might be the problem? Thanks in advance. > vcf.fn <- system.file("extdata", "sequence.vcf", package="SNPRelate") > snpgdsVCF2GDS(vcf.fn, "test.gds") Start snpgdsVCF2GDS ... Open

Dear all, I would like to be able to know the intervals of my data that overlap between them. Here it goes a small example: Input: Start End 440 443 380 443 290 468 Desired output: Start End 290 380 380 440 440 468 Best regards, João Fadista [[alternative HTML version deleted]]

Dear all, I would like to know how can I read a text file and create a data frame of only certain parts of the file. For instance, from this text file: =================================================== Matches For Query 0 (108 bases): 000019_0070 =================================================== Score Q_Name S_Name Q_Start Q_End S_Start S_End Direction Bases identity 89 000019_0070

Dear all, I would like to know how can I order a data.frame with increasing the dat$Interval (dat$Interval is a factor). There is an example below. Original data.frame: > dat Interval Number_reads 0-100 685 200-300 744 100-200 1082

Dear all, I would like to generate 25 numbers from 1 to 100 but I would like to have some numbers that could be more probable to come out. I was thinking of the function runif: runif(25, 1, 100) , but I don?t know how to give more weight to some numbers. Example: each number from 2 to 10 has the probability of 40% to come out but the probability of each number from 11 to 100 to come out is

Dear all, I would like to know if I can compare by a significance test 2 models with different kind of parameters. Perhaps I am wrong but I think that we can only compare 2 models if one is a sub model of the other. Med venlig hilsen / Regards João Fadista Ph.d. studerende / Ph.d. student AARHUS UNIVERSITET / UNIVERSITY OF AARHUS Det Jordbrugsvidenskabelige Fakultet / Faculty of

Hi, I have been using 'read.table' regularly to read tab-delimited text files with data. No problem, until now. Now I have a file that appeared to have read fine, and the data inside looks correct (structure etc), except I only had 15000+ rows out of the expected 24000. Using 'readLines' instead, and breaking up the data by tabs, gives me the expected result. I do not

Hi Guys, I am having a real hard time trying to figure out for microarry. Here is my code One-Sample t-Test dim(data.sub) [1] 10000 140 ##there are 10000 probesets and 140 columns hist(data.sub) ## Histogram. Identify if the probesets are normal distributed q<-rnorm(10000) ##generate 10000 random, normal distributed values qqplot(data.sub,q)) ##Show the plot of the probeset

Hi, I am relatively new to R and Bioconductor and am trying to filter the topTable that I generated of differentially expressed genes from my normlized eset file comprised of ~ 40 HG-133A Affy microarrays . I would like to see if particular probesets are represented in this list. Alternatively I would like to generate a topTable of differentially expressed genes using only specified probesets

Hello: I am trying to work with a couple of microarray data sets, using platform i386-pc-mingw32 arch i386 os mingw32 system i386, mingw32 status major 1 minor 8.1 year 2003 month 11 day 21 language R In the shortcut for invoking R I have set

Hi, I have a question concerning the analysis of some affymetrix chips. I downloaded some of the data from GEO GSE11324 (see below). In doing so I'm stuck after I identified the probesets with significant changes. I have problems in assigning probeset specific gene names as well as getting the genomic coordinates. Furthermore I have no clue how to deal with the fact, that most genes have