similar to: R string functions

Hi, I have a question about the data handling. I have a dataset as following: ID snp1 snp2 snp3 1001 0/0 1/1 1/1 1002 2/2 3/3 1/1 1003 4/4 3/3 2/2 I want to convert the dataset to the following format: ID snp1 snp2 snp3 1001 00 AA AA 1002 GG

Hi, I want to generate multiple sets of random numbers. The requirement is that: 1) each set have 3 random numbers; 2) the sum of the three number is always 1. how to do this? thank you, karena -- View this message in context: http://r.789695.n4.nabble.com/Random-number-generation-tp3685463p3685463.html Sent from the R help mailing list archive at Nabble.com.

I am wondering if there is any function in R that is similar to the "scan" function in SAS. I have a data.frame which has two columns as the following: one two 1 2 3 4 5 6 I used the "paste" function to create the third column: three <- paste(one,'-',two,sep="") so the data.frame is like this now: one two three 1 2 1-2 3

Hello, Suppose in the following code, PROTECT(sr = R_tryEval( .... )) sr is a RAWSXP vector. I wish to return another RAWSXP starting at position 13 onwards (base=0). I could create another RAWSXP of the correct length and then memcpy the required bytes and length to this new one. However is there a more efficient method? Regards Saptarshi Guha

I need to create 10 matrices. say matrix 1-10. matrix_1 is 1 by 1 matrix_2 is 2 by 2 matrix_3 is 3 by 3 . . . matrix_10 is 10 by 10 I am just wondering if there are some functions in R that are similar to the macro variables in SAS. so I can create these 10 matrices by doing: for (i in 1: 10) { matrix_$i <- matrix(nrow=i, ncol=i) } rather thank creating these matrices one by one

Hi Dear all, I am making Venn Diagram plots in R. I attached an example: http://r.789695.n4.nabble.com/file/n3919206/venn.jpeg I want to get rid of the black boarder line, is there any way to do it? Thank you very much, Karena -- View this message in context: http://r.789695.n4.nabble.com/A-questions-regarding-R-plots-tp3919206p3919206.html Sent from the R help mailing list archive at

I have a question about the "write.table" I have 100 data.frames, loci1, loci2, loci3.............,loci100. now, I want to print these data.frames to 100 separate files, and the names of the files are also loci1, loci2, loci3,......., loci100. how to perform this under a "for" loop? say, for (i in 1:100) { write.table(...., file='...', ........) } thank you,

Dear List, I tested the example in the reposTools vignette: library(reposTools); Loading required package: tools genRepos("Test Repository", "http://biowww.dfci.harvard.edu/~jgentry/","newRepos"); Error in rep.int(colnames(x), nr) : unimplemented type 'NULL' in 'rep' Could someone help me out with this one? I'd appreciate all help.... I am

I have a file like this: id n1 n2 n3 n4 n5 n6 1 3 4 7 8 10 2 2 4 1 2 4 3 10 3 7 0 0 0 0 8 4 10 1 0 0 2 3 5 11 1 0 0 0 5 what I want to do is: only if n2=0 and n3=0 and n4=0 and n5=0 then delete the row. how can I do that? thank you, karena -- View this message

hi, I have a question about importing data in R. I want to import a file which has missing value in it, and the missing values are denoted as ".", I want to first read in the file, and then change the "." into the number zero "0". how can I do that? thank you, karena -- View this message in context:

hello, plot(running(-log10(results_chr_p$empi_p), fun=mean, width=41, font.axis=4, by=1),type="l",cex=0.1, ylab="-Log(p)", ylim=c(0,5.0), xlab=" ", lwd=2) this is my code to make a plot. The problem is, now I want to add one more curve to the plot, which is for another variable in the data.frame -log10(results_chr_p$p). My question is: how to make multiple lines

Following is a function that I wrote (It is working well). It's a simple one, nothing complicated. The only question that I have is a qutation mark issue, I guess. ############################################# funcname <- function(trait.file){ #line1 setwd('/root/subroot') # line 2 load('imge.RData')

I have a data.frame as the following: var1 var2 9G/G09 abd89C/T90 10A/T9 32C/C 90G/G A/A . . . . . . 10T/C 00G/G90 What I want is to get the letters which are on the left and right of '/'. for example, for "9G/G09", I only want "G", "G", and for "abd89C/T90", I only want "C" and

I have a data.frame as follows: v1 v2 v3 v4 v5.....v100 1 1 0 0 1 2 2 1 2 1 0 1 1 1 1 2 1 0 . . . . . . . . . . . . 1 2 2 1 1 0 so for this data set, what I wanna do is to replace all the

Hi, I am working on transforming a SAS code to R code. It's about the survival analysis and the SAS code is as below: -------------------------------------- proc lifetest data=surdata plot=(s); time surv*censht(1); strata educ; title 'Day 1 homework'; run; ---------------------------------------- here is the data: subject surv censht educ 1 78 1 1 2

Hi, I have a data.frame as following: var1 var2 1 ab_c_(ok) 2 okf789(db)_c 3 jojfiod(90).gt 4 "ij"_(78)__op 5 (iojfodjfo)_ab what I want is to create a new variable called "var3". the value of var3 is the content in the Parentheses. so var3 would be: var3 ok db 90 78 iojfodjfo how to do this? thanks, karena --

If a text file has rows of variable lengths. How to read the file into R? I think some people may suggest using 'fill=T', however, it sort of messes the data up, for example, in the text file: a b c d 1 2 3 4 1 8 6 1 2 0 1 1 0 If I read in the file using 'read.table("data", head=T, fill=T), then the data.frame in R will

Hi, I've got a quite tricky question. I have a txt file, named 'temp.txt', as the following: snp1 snp2 snp3 AA 00 00 GG GG 00 00 AA 00 I want to read the file into R. 1) when I use 'read.table' without 'header=T' option, > temp <- read.table('temp.txt') # I got > temp V1

Hi, do you guys know what function in R handles the multiple regression on categorical predictor data. i.e, 'lm' is used to handle continuous predictor data. thanks, karena -- View this message in context: http://r.789695.n4.nabble.com/regression-function-for-categorical-predictor-data-tp2532045p2532045.html Sent from the R help mailing list archive at Nabble.com.

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]