similar to: identifying when one element of a row has a positive number

Good afternoon list, I have the following character strings; one with spaces between the maths operators and variable names, and one without said spaces. form<-c('~ Sentence + LEGAL + Intro + Intro / Intro1 + Intro * LEGAL + benefit + benefit / benefit1 + product + action * mean + CTA + help + mean * product')

Dear R experts, I have a matrix (from some sort of classification) like this: object group [1,] 1 1 [2,] 2 2 [3,] 3 1 [4,] 4 1 [5,] 5 3 And I need something like this: [,1] [,2] [,3] [,4] [,5] [1,] 1 0 1 1 0 [2,] 0 1 0 0 0 [3,] 1 0 1 1 0 [4,] 1 0 1 1 0 [5,] 0 0 0 0 1 where all

hi, I have 2 files example 1 and example 2 and would like to know what is in example2 and not in example1 (attached) V1 contain data which could be in duplicated which I am using as identifiers I used setdiff(example2$V1,example1$V1) to find the identifiers which are specific to example2: [1] "rs2276598" "rs17253672" I am looking for a way to get an output with all

Ilia Mirkin <imirkin at alum.mit.edu> writes: > On Wed, Feb 6, 2019 at 3:28 PM Dan Espen <dan1espen at gmail.com> wrote: >> >> Ilia Mirkin <imirkin at alum.mit.edu> writes: >> >> > It would be useful to know how the screen is connected. Also please >> > grab the monitor's EDID from /sys/class/drm/cardN-connector/edid and >> >

Ilia Mirkin <imirkin at alum.mit.edu> writes: > It would be useful to know how the screen is connected. Also please > grab the monitor's EDID from /sys/class/drm/cardN-connector/edid and > attach it here. It would also be interesting to get a boot with > "drm.debug=0x1e nouveau.debug=disp=trace" which has the modeswitch in > question. The screen is connected

https://bugs.freedesktop.org/show_bug.cgi?id=109654 Bug ID: 109654 Summary: Nouveau picks bad mode setting 640x480 resolution Product: xorg Version: 7.7 (2012.06) Hardware: x86-64 (AMD64) OS: Linux (All) Status: NEW Severity: normal Priority: medium Component: Driver/nouveau

On Sat, Feb 16, 2019 at 12:49 PM Dan Espen <dan1espen at gmail.com> wrote: > > Dan Espen <dan1espen at gmail.com> writes: > > > Ilia Mirkin <imirkin at alum.mit.edu> writes: > > > >> On Wed, Feb 6, 2019 at 3:28 PM Dan Espen <dan1espen at gmail.com> wrote: > >>> > >>> Ilia Mirkin <imirkin at alum.mit.edu> writes:

I just upgraded a box to 1.2.3 this morning after encountering the issues noted earlier on the list. Everything is great. In fact, a LOT better. In the past few weeks, I've been battling with BV to address dropped outgoing voice packets (the flipside is that I haven't experienced this with other providers during tests), and an annoying mechnical 'chirp' at the start of a call.

On Tue, Dec 04, 2018 at 08:03:53AM +0100, Andrzej Hajda wrote: > On 03.12.2018 22:48, Ville Syrjälä wrote: > > On Thu, Nov 29, 2018 at 09:46:16AM +0100, Andrzej Hajda wrote: > >> Quite late, hopefully not too late. > >> > >> > >> On 21.11.2018 12:51, Ville Syrjälä wrote: > >>> On Wed, Nov 21, 2018 at 01:40:43PM +0200, Jani Nikula wrote: >

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Dev-Cpp is a IDE that can be used with MinGW and GCC but its causing problems. I installed MinGW since I am used to ./configure type builds but im unsure if this is a tinc issue or OpenSSL issue. I installed openssl 0.9.8e and I get to the following, $./configure ... checking openssl/evp.h usability... yes ... checking for openssl/engine.h... yes checking for SHA1_version in -lcrypto... no

On Thu, Nov 29, 2018 at 09:46:16AM +0100, Andrzej Hajda wrote: > Quite late, hopefully not too late. > > > On 21.11.2018 12:51, Ville Syrjälä wrote: > > On Wed, Nov 21, 2018 at 01:40:43PM +0200, Jani Nikula wrote: > >> > >>> return; > >>> diff --git a/drivers/gpu/drm/bridge/sil-sii8620.c b/drivers/gpu/drm/bridge/sil-sii8620.c >

On Fri, Oct 02, 2015 at 06:05:21PM -0400, Ilia Mirkin wrote: > Could you advise what the proper way of indicating > that the memory is "global" to the op? I'm sure I'm just missing > something simple. If you show me what to look for in SM35 I can > probably find it on my own for SM20/SM30/SM50. Sorry again for the delay. Here's what I've been able to find

Hello ! I have a database server running in a RH9 machine with two networks interfaces, but the second interface (10.0.1.1) does only clustering with another server, i have a PDC and WINS Server resident on a Win2000 machine. I had have troubles on find my linux machine in a network neighborhood from a Win machine. So i verified the linux machine registration in WINS server and i could see the

Well I think we all need to look at something like this first. We will be one of the first people in Europe who will be selling this. If anyone is interested do drop me an email. Picture of the phone can be found here. http://cyber-telecom.net/wifi-gsm.jpg GSM / VoIP Over WiFi Dual-Mode Phone CYBER-TELECOM released the world first commercial GSM/VoIP Over WiFi dual-mode smart phone, in

Hello there. I have a setup with Samba AD and a Named backend. Everything has been working fine, until a few days ago, I cannot start the DNS snap-in from windows. I get a dialog box saying "Access was denied. Would you like to add it anyway?" If I enable level 3 debugging in the samba.conf, I get the following: [2017/05/11 07:25:30.413481, 3]

On Fri, Oct 2, 2015 at 6:14 PM, Robert Morell <rmorell at nvidia.com> wrote: > Hi Ilia, > > On Fri, Oct 02, 2015 at 06:05:21PM -0400, Ilia Mirkin wrote: >> Hi Robert, >> >> Thanks for the quick response! That goes in line with my observations >> which is that these things happen when using an ATOM/RED instruction. >> I've checked and rechecked that

Hi all, Given a matrix: > mat [,1] [,2] [,3] [1,] 0 0 0 [2,] 3 3 3 [3,] 1 1 1 [4,] 2 1 1 How can I convert it to a list of strings: > desired_output [1] "aaa" "ttt" "ccc" "gcc" In principle: 1. Number of Column in matrix = length of string (= 3) 2. Number of Row in matrix = length of vector ( = 4). 3.

On Wed, Nov 21, 2018 at 01:40:43PM +0200, Jani Nikula wrote: > On Tue, 20 Nov 2018, Ville Syrjala <ville.syrjala at linux.intel.com> wrote: > > From: Ville Syrjälä <ville.syrjala at linux.intel.com> > > > > Make life easier for drivers by simply passing the connector > > to drm_hdmi_avi_infoframe_from_display_mode() and > >

Hello help, I have changed around some graphing code and made it into a function. Previously they y label of the axis was inserted as text in its own layout box. text(1,1, expression(~degree~C),cex=1) This worked great and resulted in the symbol for degree. In the function, I have changed it so: text(1,1,paste(b_unit),cex=1) and b_unit<-expression(~degree~C) This now inserts ~degree~C