similar to: String split and concatenation

Hi guys, Are there any feasible methods in searching & finding non-ASCII characters in R? For example, from the following object, x <- mia. SzaÌmitaÌó The desired output is, x.out <- mia. SzaImitaIA Your help in resolving this would be greatly appreciated. [[alternative HTML version deleted]]

Dear R users, I am trying to extract the rownames of a data set for which each columns meet a certain criteria. (condition - elements of each column to be equal 1) I have the correct result, however I am seeking for more efficient (desire vectorization) way in implementing such problem as it can get quite messy if there are hundreds of columns. Arbitrary data set and codes are shown below for

Last week one of our clients reported trouble with a csv file I generated with write.table. He said that columns with quotes for character variables were rejected by their data importer, which was revised to match the way Microsoft Excel uses quotation marks in character variables. I explained to them that quoted character variables are virtuous and wise, of course, but they say Microsoft Excel

Hi helpeRs, I have inherited a set of data files that use the file system as a sort of poor man's database, i.e., the data files are nested in directories that indicate which city they come from. For example: dir.create("deleteme") for(i in paste("deleteme", c("New York", "Los Angeles"), sep="/")) { dir.create(i) for(j in

Hi, I would like to substitute a semicolon with two double quotation marks and a comma inbetween. It suppose to look like that: I have: FBpp0070086;FBpp0099643;FBpp0112915 I would like to have: "FBpp0070086","FBpp0099643","FBpp0112915" I tried with various numbers of backslashes, but noe have worked. for example: gsub(";", "\\\",\"",

An embedded and charset-unspecified text was scrubbed... Name: not available URL: <https://stat.ethz.ch/pipermail/r-help/attachments/20091123/36ef28cf/attachment-0001.pl>

Dear all, I have 100 files which are used as input.and I have to input the name of my files again and again.the name of the files are 1.out, 2.out......100.out. I want to know if there is anything like perl so that i can use something like this- for($f = 1; $f <= 100; $f++) { $file = $f.".out"; I have tried this thing in R but it does not work.Can somebody please help me.

i am trying to fit a linear model with both continuous covariates and factors. When fitted with the intercept term the first level of the factor is treated by R as intercept and the estimate of the effects of remaining levels(say i th level) are given as true estimate of i th level - estimate of 1st level.can any please help me? thanks in advance..... -- View this message in context:

Hi all, I am currently woking with hundreds of objects in workspace and whenever I invoke ls() to observe the names of the objects, there are too much of unnecessary variables. For example, if I only require say 3 or 4 objects from hundreds of objects in workspace, are there any methods that may do the job? I have tried rm(-c(x,xx,xxx)), but no luck.. Your feedback in this problem would be

Some help with how to re-label the vertical axis in a histogram would be appreciated. qplot(off.sc,weight=rel.freq,binwidth=.29,main="test Figure"+ylab("New from inside"))+ylab("New from outside")+ xlab("off.sc\nAggregated frequency plots for 17 equal intervals.") The code

Hi everyone, Is there a way to make R save the workspace output (just the results, not the objects themselves) as you go? I'm running analysis that takes a long time to run and I want to be able to interrupt it without losing all the output to date. Is there an alternative to putting "save.image()" commands after every couple lines of code? Best, Tatyana

Hi, how do I convert a character vector into a string? c("a","b","c") into "a b c" Thanks! [[alternative HTML version deleted]]

Dear all I have a simple R question. How do I execute R-code stored in a variable? E.g if I have a variable which contains some R-code: c = "reg <- lm(sales$sales~sales$price)" Is it possible to execute c E.g like Exec(c) I hope someone can help. Thank you Kim Lillesøe [[alternative HTML version deleted]]

Dear R users, I have numerous data sets (csv files) saved in the folder which has the same name as individual data. (i.e data x1 saved in x1 folder, data x2 in x2 folder etc) I would like to read in the desired data set name using 'scan' function and assign this inputted value to an object so that it can be used in the 'read.csv' function. For example, x <- scan() 1: 0708

Hi R-helpers, I have a character string, for example: "lm(y ~ X2 + X3 + X4)" from which I would like to strip off the leading and trailing quotation marks resulting in this: lm(y ~ X2 + X3 + X4) I have tried using gsub() but I can't figure out how to specify the quotation mark using a regular expression. Alternatively, I would like a function that lets me delete the leading

Hello, Here are three vectors to give context to my question below: *id <- c(1,1,1,1,1,2,2,2,3,3,3)) month <- c(1, 1, 2, 3, 6, 2, 3, 6, 1, 3, 5) value <- c(10, 12, 11, 14, 16, 12, 10, 8, 14, 11, 15)* and I want to plot "value" over "month" separately for each "id". Before I can do that, I need to section both month and value, based on ID. I create a

Hi all, I think I'm cracking up. Please help me understand why I'm getting different results with m.test and m.test2 in the example below. > library(reshape) Loading required package: plyr > > m.test <- data.frame(id = factor(rep(1:10, 2)), variable=rep(c("var1","var2"),10), value=rnorm(20)) > cast(m.test, ...~variable, value="value") ## cast

Dear R helpers, I am trying to understand how to use the independence_test function in the coin package. I think I suffer from a misunderstanding about what the package does. Either that or I do not understand how to use it properly. Specifically, I cannot understand if I can test independence of arbitrary statistics. Take the following example: set.seed(10) d <- data.frame(y = c(rnorm(10,

Dear R Users, I would like to know is there any package to create a plot like this? http://dl.dropbox.com/u/5409929/cs1160521f01.gif X axis is categorical. And the positions of the points are corresponding to the frequency. (similar to violinplot) Thank you. Regards, CH -- CH Chan

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context: