Displaying 20 results from an estimated 20000 matches similar to: "Convert character vector into string"
2009 Nov 20
2
Finding & replacing non-ASCII characters
Hi guys,
Are there any feasible methods in searching & finding non-ASCII characters
in R?
For example, from the following object,
x <- mia. SzaÌmitaÌó
The desired output is,
x.out <- mia. SzaImitaIA
Your help in resolving this would be greatly appreciated.
	[[alternative HTML version deleted]]
2011 Aug 22
3
automatic file input
Dear all,
I have 100 files which are used as input.and I have to input the name of  my files again and again.the name of the files are 1.out, 2.out......100.out.
I want to know if there is anything like perl so that i can use something like this-
for($f = 1; $f <= 100; $f++) {
  $file = $f.".out";
I have tried this thing in R but it does not work.Can somebody please help me.
2011 Feb 11
6
linear models with factors
i am trying to fit a linear model with both continuous covariates and
factors. When fitted with the intercept 
term the first level of the factor is treated by R as intercept and the
estimate of the effects of remaining levels(say i th level)  are given as 
true estimate of i th level - estimate of 1st level.can any please help me?
thanks in advance.....
-- 
View this message in context:
2011 Mar 11
4
Any existing functions for reading and extracting data from path names?
Hi helpeRs,
I have inherited a set of data files that use the file system as a
sort of poor man's database, i.e., the data files are nested in
directories that indicate which city they come from. For example:
dir.create("deleteme")
for(i in paste("deleteme", c("New York", "Los Angeles"), sep="/")) {
    dir.create(i)
    for(j in
2011 Jul 25
4
ggplot question: changing the label for the Y axis on a histogram
Some help with how to re-label the vertical axis in a histogram  would be appreciated.
                qplot(off.sc,weight=rel.freq,binwidth=.29,main="test Figure"+ylab("New from inside"))+ylab("New from outside")+
                                                                xlab("off.sc\nAggregated frequency plots for 17 equal intervals.")
The code
2011 Feb 21
2
Equivalent of log file in R?
Hi everyone,
Is there a way to make R save the workspace output (just the results,
not the objects themselves) as you go? I'm running analysis that takes
a long time to run and I want to be able to interrupt it without
losing all the output to date. Is there an alternative to putting
"save.image()" commands after every couple lines of code?
Best,
Tatyana
2010 Jan 25
1
reshape package cast() function
Hi all,
I think I'm cracking up. Please help me understand why I'm getting
different results with m.test and m.test2 in the example below.
> library(reshape)
Loading required package: plyr
>
> m.test <- data.frame(id = factor(rep(1:10, 2)), variable=rep(c("var1","var2"),10), value=rnorm(20))
> cast(m.test, ...~variable, value="value") ## cast
2009 Oct 25
1
A naive question about permutation tests in the coin package
Dear R helpers,
I am trying to understand how to use the independence_test function in
the coin package. I think I suffer from a misunderstanding about what
the package does. Either that or I do not understand how to use it
properly. Specifically, I cannot understand if I can test independence
of arbitrary statistics.
Take the following example:
set.seed(10)
d <- data.frame(y = c(rnorm(10,
2011 Jul 26
2
Accessing the index of factor in by() function
Hello,
Here are three vectors to give context to my question below:
*id    <- c(1,1,1,1,1,2,2,2,3,3,3))
month <- c(1, 1, 2, 3, 6, 2, 3, 6, 1, 3, 5)
value <- c(10, 12, 11, 14, 16, 12, 10, 8, 14, 11, 15)*
and I want to plot "value" over "month" separately for each "id". Before I
can do that, I need to section both month and value, based on ID. I create a
2011 Mar 08
3
A plot similar to violin plot
Dear R Users,
I would like to know is there any package to create a plot like this?
http://dl.dropbox.com/u/5409929/cs1160521f01.gif
X axis is categorical. And the positions of the points are
corresponding to the frequency. (similar to violinplot)
Thank you.
Regards,
CH
-- 
CH Chan
2011 Sep 13
3
ggplot - class "character" problem
Hi
I'm trying to use ggplot2 to chart a dataset that I've drawn in from
excel.? When I run the qplot command, I get the following error
message:
Error: ggplot2 doesn't know how to deal with data of class character
It feels like I need to coerce one of the fields in my data frame.
Here's the code, which is short:
#draw data in from network location
2010 Mar 04
4
Analogue to SPSS regression commands ENTER and REMOVE in R?
I am not sure if this question has been asked before - but is there a
procedure in R (in lm or glm?) that is equivalent to ENTER and REMOVE
regression commands in SPSS?
Thanks a lot!
-- 
Dimitri Liakhovitski
Ninah.com
Dimitri.Liakhovitski at ninah.com
2011 Sep 08
2
ggplot geom_freqpoly() layers ..?
Hi,
I was trying to overlay/combine two freqpoly plots. The sample code below
illustrates the problem. Essentially, I want to do is:
1. Have the same colour for all the lines in 'Plot 1' (and 'Plot 2').
Currently, all the lines in Plot 1 have different colours and all the lines
in Plot 2 have different colors. I'd like for all lines in Plot 1 to be
'red' and all the
2011 Feb 04
4
aggregate function - na.action
Can someone please tell me what is up with na.action in aggregate?
My (somewhat) reproducible example:
(I say somewhat because some lines wouldn't run in a separate session, more
below)
set.seed(100)
dat=data.frame(
        x1=sample(c(NA,'m','f'), 100, replace=TRUE),
        x2=sample(c(NA, 1:10), 100, replace=TRUE),
        x3=sample(c(NA,letters[1:5]), 100, replace=TRUE),
2011 Mar 25
4
two plots in qplot
Hello
I simply want to plot two variables against one 'year' variable in
qplot.
Is any way of doing this without reshaping data in long format and using
facet function afterwards?
Thank you
Denis
2011 Aug 11
2
Extract values from a data frame
Hi everyone,
I have a data frame that looks *sort of* like this:
name <- letters[1:5]
signal.1 <- c("12", "bad signal", "noise", "10", "X")
length.signal.1 <- 5:9
intensity.signal.1 <- 3:7
signal.2 <- c("13", "noise", "19.2", "X", "V")
length.signal.2 <- 2:6
intensity.signal.2
2011 Aug 16
2
merge(join) problem
I have two datasets:
A with columns Open and Name (and many others, irrelevant to the merge)
B with columns Time and Name (and many others, irrelevant to the merge)
I want the dataset AB with all these columns
Open from A - a difftime (time of day)
Time from B - a difftime (time of day)
Name (same in A & B) - a factor, does NOT index rows, i.e., there are
_many_ rows in both A & B with
2010 Jan 26
4
reading a string vector
Hi, I need to read a string vector in R which is like this
"atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as
a unique vector input when I read in like x <-
"atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I
can use each of the letters on my reading?
Thanks,
Beatriz
-- 
View this message in context:
2011 Mar 09
2
R console Mac
Hi there,
I recently switched to Mac and I wonder if there is any way to get the R
console to autocomplete names of list objects or slots of objects. The
command line version allows to type e.g. list$ and two times the tab
button and then comes up with the names of the list objects. Same for slots of e.g. Eset objects
like eset. Unfortunately this does not work in the Mac R console.
Is there a
2010 Mar 12
1
Installing R cmdr
Dear John Fox,
I am using Snowleopard with a Intel Core 2 Duo processor.  I have installed the R console and followed your steps at:
http://socserv.mcmaster.ca/jfox/Misc/Rcmdr/installation-notes.html
but every time I try "library(Rcmdr)" it loads Tcl/tk infinitely.  I have tried loading "library(tcltk)" by itself and it does the same thing.  I have tried with X11 running to