similar to: Convert character vector into string

Hi guys, Are there any feasible methods in searching & finding non-ASCII characters in R? For example, from the following object, x <- mia. SzaÌmitaÌó The desired output is, x.out <- mia. SzaImitaIA Your help in resolving this would be greatly appreciated. [[alternative HTML version deleted]]

Dear all, I have 100 files which are used as input.and I have to input the name of my files again and again.the name of the files are 1.out, 2.out......100.out. I want to know if there is anything like perl so that i can use something like this- for($f = 1; $f <= 100; $f++) { $file = $f.".out"; I have tried this thing in R but it does not work.Can somebody please help me.

i am trying to fit a linear model with both continuous covariates and factors. When fitted with the intercept term the first level of the factor is treated by R as intercept and the estimate of the effects of remaining levels(say i th level) are given as true estimate of i th level - estimate of 1st level.can any please help me? thanks in advance..... -- View this message in context:

Hi helpeRs, I have inherited a set of data files that use the file system as a sort of poor man's database, i.e., the data files are nested in directories that indicate which city they come from. For example: dir.create("deleteme") for(i in paste("deleteme", c("New York", "Los Angeles"), sep="/")) { dir.create(i) for(j in

Some help with how to re-label the vertical axis in a histogram would be appreciated. qplot(off.sc,weight=rel.freq,binwidth=.29,main="test Figure"+ylab("New from inside"))+ylab("New from outside")+ xlab("off.sc\nAggregated frequency plots for 17 equal intervals.") The code

Hi everyone, Is there a way to make R save the workspace output (just the results, not the objects themselves) as you go? I'm running analysis that takes a long time to run and I want to be able to interrupt it without losing all the output to date. Is there an alternative to putting "save.image()" commands after every couple lines of code? Best, Tatyana

Hi all, I think I'm cracking up. Please help me understand why I'm getting different results with m.test and m.test2 in the example below. > library(reshape) Loading required package: plyr > > m.test <- data.frame(id = factor(rep(1:10, 2)), variable=rep(c("var1","var2"),10), value=rnorm(20)) > cast(m.test, ...~variable, value="value") ## cast

Dear R helpers, I am trying to understand how to use the independence_test function in the coin package. I think I suffer from a misunderstanding about what the package does. Either that or I do not understand how to use it properly. Specifically, I cannot understand if I can test independence of arbitrary statistics. Take the following example: set.seed(10) d <- data.frame(y = c(rnorm(10,

Hello, Here are three vectors to give context to my question below: *id <- c(1,1,1,1,1,2,2,2,3,3,3)) month <- c(1, 1, 2, 3, 6, 2, 3, 6, 1, 3, 5) value <- c(10, 12, 11, 14, 16, 12, 10, 8, 14, 11, 15)* and I want to plot "value" over "month" separately for each "id". Before I can do that, I need to section both month and value, based on ID. I create a

Dear R Users, I would like to know is there any package to create a plot like this? http://dl.dropbox.com/u/5409929/cs1160521f01.gif X axis is categorical. And the positions of the points are corresponding to the frequency. (similar to violinplot) Thank you. Regards, CH -- CH Chan

Hi I'm trying to use ggplot2 to chart a dataset that I've drawn in from excel.? When I run the qplot command, I get the following error message: Error: ggplot2 doesn't know how to deal with data of class character It feels like I need to coerce one of the fields in my data frame. Here's the code, which is short: #draw data in from network location

I am not sure if this question has been asked before - but is there a procedure in R (in lm or glm?) that is equivalent to ENTER and REMOVE regression commands in SPSS? Thanks a lot! -- Dimitri Liakhovitski Ninah.com Dimitri.Liakhovitski at ninah.com

Hi, I was trying to overlay/combine two freqpoly plots. The sample code below illustrates the problem. Essentially, I want to do is: 1. Have the same colour for all the lines in 'Plot 1' (and 'Plot 2'). Currently, all the lines in Plot 1 have different colours and all the lines in Plot 2 have different colors. I'd like for all lines in Plot 1 to be 'red' and all the

Can someone please tell me what is up with na.action in aggregate? My (somewhat) reproducible example: (I say somewhat because some lines wouldn't run in a separate session, more below) set.seed(100) dat=data.frame( x1=sample(c(NA,'m','f'), 100, replace=TRUE), x2=sample(c(NA, 1:10), 100, replace=TRUE), x3=sample(c(NA,letters[1:5]), 100, replace=TRUE),

Hello I simply want to plot two variables against one 'year' variable in qplot. Is any way of doing this without reshaping data in long format and using facet function afterwards? Thank you Denis

Hi everyone, I have a data frame that looks *sort of* like this: name <- letters[1:5] signal.1 <- c("12", "bad signal", "noise", "10", "X") length.signal.1 <- 5:9 intensity.signal.1 <- 3:7 signal.2 <- c("13", "noise", "19.2", "X", "V") length.signal.2 <- 2:6 intensity.signal.2

I have two datasets: A with columns Open and Name (and many others, irrelevant to the merge) B with columns Time and Name (and many others, irrelevant to the merge) I want the dataset AB with all these columns Open from A - a difftime (time of day) Time from B - a difftime (time of day) Name (same in A & B) - a factor, does NOT index rows, i.e., there are _many_ rows in both A & B with

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

Hi there, I recently switched to Mac and I wonder if there is any way to get the R console to autocomplete names of list objects or slots of objects. The command line version allows to type e.g. list$ and two times the tab button and then comes up with the names of the list objects. Same for slots of e.g. Eset objects like eset. Unfortunately this does not work in the Mac R console. Is there a

Dear John Fox, I am using Snowleopard with a Intel Core 2 Duo processor. I have installed the R console and followed your steps at: http://socserv.mcmaster.ca/jfox/Misc/Rcmdr/installation-notes.html but every time I try "library(Rcmdr)" it loads Tcl/tk infinitely. I have tried loading "library(tcltk)" by itself and it does the same thing. I have tried with X11 running to