similar to: macro variable in R?

Hello! I've a problem with the combn function and a set of vector. I would like to make a simple combination where, instead of scalars, i would like to combine vector, in order to form matrixes. In other words, i have nineteen 6-items vectors (for example coef1-coef19), that i would like to combine in n!/k!(n-k)! 6x6 matrixes. I tried with a code like this mma <-

I have written the R code below to perform White's Data Mining Reality Check (DMRC) but as it stands at the moment it is painfully slow. It is written as a function as I call it many times from a script file with different data input, and the output is sunk() to a text file. Could anyone suggest improvements to the code to increase its speed? boot_white_test <- function(data) {

I have a file like this: id n1 n2 n3 n4 n5 n6 1 3 4 7 8 10 2 2 4 1 2 4 3 10 3 7 0 0 0 0 8 4 10 1 0 0 2 3 5 11 1 0 0 0 5 what I want to do is: only if n2=0 and n3=0 and n4=0 and n5=0 then delete the row. how can I do that? thank you, karena -- View this message

Hi, I have a data.frame as following: var1 var2 1 ab_c_(ok) 2 okf789(db)_c 3 jojfiod(90).gt 4 "ij"_(78)__op 5 (iojfodjfo)_ab what I want is to create a new variable called "var3". the value of var3 is the content in the Parentheses. so var3 would be: var3 ok db 90 78 iojfodjfo how to do this? thanks, karena --

I have a data.frame as the following: var1 var2 9G/G09 abd89C/T90 10A/T9 32C/C 90G/G A/A . . . . . . 10T/C 00G/G90 What I want is to get the letters which are on the left and right of '/'. for example, for "9G/G09", I only want "G", "G", and for "abd89C/T90", I only want "C" and

Hi, I've got a quite tricky question. I have a txt file, named 'temp.txt', as the following: snp1 snp2 snp3 AA 00 00 GG GG 00 00 AA 00 I want to read the file into R. 1) when I use 'read.table' without 'header=T' option, > temp <- read.table('temp.txt') # I got > temp V1

Following is a function that I wrote (It is working well). It's a simple one, nothing complicated. The only question that I have is a qutation mark issue, I guess. ############################################# funcname <- function(trait.file){ #line1 setwd('/root/subroot') # line 2 load('imge.RData')

Hi, I have a question about the data handling. I have a dataset as following: ID snp1 snp2 snp3 1001 0/0 1/1 1/1 1002 2/2 3/3 1/1 1003 4/4 3/3 2/2 I want to convert the dataset to the following format: ID snp1 snp2 snp3 1001 00 AA AA 1002 GG

Hi, I want to generate multiple sets of random numbers. The requirement is that: 1) each set have 3 random numbers; 2) the sum of the three number is always 1. how to do this? thank you, karena -- View this message in context: http://r.789695.n4.nabble.com/Random-number-generation-tp3685463p3685463.html Sent from the R help mailing list archive at Nabble.com.

Hi Dear all, I am making Venn Diagram plots in R. I attached an example: http://r.789695.n4.nabble.com/file/n3919206/venn.jpeg I want to get rid of the black boarder line, is there any way to do it? Thank you very much, Karena -- View this message in context: http://r.789695.n4.nabble.com/A-questions-regarding-R-plots-tp3919206p3919206.html Sent from the R help mailing list archive at

I have a question about the "write.table" I have 100 data.frames, loci1, loci2, loci3.............,loci100. now, I want to print these data.frames to 100 separate files, and the names of the files are also loci1, loci2, loci3,......., loci100. how to perform this under a "for" loop? say, for (i in 1:100) { write.table(...., file='...', ........) } thank you,

Hi, I have a string "GGGGGGCCCAATCGCAATTCCAATT" What I want to do is to count the percentage of each letter in the string, what string functions can I use to count the number of each letter appearing in the string? For example, the letter "A" appeared 6 times, letter "T" appeared 5 times, how can I use a string function to get the these number? thanks, karena

hi, I have a question about importing data in R. I want to import a file which has missing value in it, and the missing values are denoted as ".", I want to first read in the file, and then change the "." into the number zero "0". how can I do that? thank you, karena -- View this message in context:

hello, plot(running(-log10(results_chr_p$empi_p), fun=mean, width=41, font.axis=4, by=1),type="l",cex=0.1, ylab="-Log(p)", ylim=c(0,5.0), xlab=" ", lwd=2) this is my code to make a plot. The problem is, now I want to add one more curve to the plot, which is for another variable in the data.frame -log10(results_chr_p$p). My question is: how to make multiple lines

I am wondering if there is any function in R that is similar to the "scan" function in SAS. I have a data.frame which has two columns as the following: one two 1 2 3 4 5 6 I used the "paste" function to create the third column: three <- paste(one,'-',two,sep="") so the data.frame is like this now: one two three 1 2 1-2 3

I have a data.frame as follows: v1 v2 v3 v4 v5.....v100 1 1 0 0 1 2 2 1 2 1 0 1 1 1 1 2 1 0 . . . . . . . . . . . . 1 2 2 1 1 0 so for this data set, what I wanna do is to replace all the

If a text file has rows of variable lengths. How to read the file into R? I think some people may suggest using 'fill=T', however, it sort of messes the data up, for example, in the text file: a b c d 1 2 3 4 1 8 6 1 2 0 1 1 0 If I read in the file using 'read.table("data", head=T, fill=T), then the data.frame in R will

Hi, I am using 'igraph' to make some plots. The problem I got is that I don't know how to label the nodes with gene names. My sample code: ## suppose I have 100 gene (nodes) ## --------------------------------------------------------------------------- graph <- set.vertex.attribute(graph, "color", value=c(rep(c('green','red'),50))) graph <-

Hi, I am doing an analysis to see if these is tissue specific effects on the gene expression data . Our data were collected from 6 different labs (batch effects). lab 1 has tissue type 1 and tissue type 2, lab 2 has tissue 3, 4,5,6. The other labs has one tissue type each. The 'sample' data is as below:

I am using 'igraph' package to make some graphs of 'gene-gene interaction'. I can get a data.frame which has three columns. gene1 gene2 pvalue AGT MLR 1.2e-04 MLR 11BHSD1 1.71e-05 IFG2 11BHSD2 2.2e-07 . . . . . . . . . AGTR1 NPPA