similar to: scatterplot in Package CAR

Hi I am trying to plot two simple graphs with a grid in background. The axis and grid appears in correct position, but the actual data are not there.... Can somebody provide me a hint what is missing? The code is: pln <- read.table(file="PLN.txt", header=TRUE, dec=",") par(mfrow=c(1,2)) plot(pln[,1], type="l", lwd="2", ylab="EUR/PLN",

Hello, I want to compute Wainer et al's augmented subscore(2001) using IRT but I can't find any packages or relevant code. There is a 'subscore' package in R, but I think it only gives functions to calculate augmented subscores using CTT(classical test theory). Is there other package or code to compute subscores using IRT? If it is not, is there any plan to develop it in

I am trying to simulate a dataset using Parallel Latent CTT model and this is what i have done so far: (START) #Importing psych library for all the simulation related functions library(psych) # Settting the working directory path to C:/NCME path="C:/NCME" setwd(path) #Using the function to generate the data GenData <- congeneric.sim(N=500, loads =

I have no idea, but Google pointed me to this https://cran.r-project.org/web/packages/subscore/index.html Hth Ulrik "Hyunju Kim" <asdfg4882 at yonsei.ac.kr> schrieb am Di., 15. Mai 2018, 07:21: > > > > Hello, > > > > I want to compute Wainer et al's augmented subscore(2001) using IRT but I > can't find any packages or relevant code. > >

Dear all r-users,   I have this code below to draw two squares, small and big square.  I would like to colour the small square with red and the big square with blue for example.  I tried using polygon but fail.  Thank you so much for your help.     par(mar=c(4,4,2,1.2),oma=c(0,0,0,0),xaxs="i", yaxs="i") plot.new() plot.window(xlim= c(0,8),

Hi, I'm trying to recreate a sensitivity-specificity graph using the histbackback function. The only problem is that these graphs are typically drawn with vertical rather than horizontal bar plots (and the histbackback function only seems to work with horiz=TRUE argument, using "horiz=FALSE" doesn't work). Does anyone know if: 1) there's a different graphing function that

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

Hi All, I'm generating 10 different data sets with 1 and 0 in a matrix form and writing the output in separate files. Now I need to stack all these data sets in one vector and I know that stack only operates on list or data frame however I got these data sets by converting list to a matrix so can't go backwards now. Is there a way i can still use Stack? Please see the program:

Alright, going ot ask this question in advance of doing bone headed tests. I have one application that does not understand the idea of /usr/local/ and insists on populating /usr. Of course it is closed source and commercial and it is the one they want to use. Below is the list of junk it shoves in /usr/share. Between the Type Reference guide and another email , I believe I can move this tree

Dear All, Following Zhang instructions I add the environmental variables, but now I receive the following message: > library(tcltk) Error in firstlib(which.lib.loc, package) : Can't find a usable init.tcl in the following directories: { C:\tcl\lib\tcl8.3} This probably means that Tcl wasn't installed properly. Error in library(tcltk) : .First.lib failed I'm using R Win

There is still issues with the reversed y-log scale plot: # Test case A: works as expected plot(10:100,log="y",ylim=c(100,11)) grid() par("yaxp") # Test case B: grid does not have horizontal lines; par("yaxp") is different plot(1:100,log="y",ylim=c(100,10)) grid() par("yaxp") In the second test case, axTicks for the horizontal lines (in

Dear Professor Revelle and R-helpers, This is a two-part question: the first part is general, and the second is specific to the psych package. First question: In the past I've constructed composite variables from questionnaire data by using rowMeans(), and then correlating items with the scale using cor() as an informal check for "bad" items. Over the weekend I decided to take a

A question on p-value of Unit Root Tests using “urca” toolbox There’s a function “punitroot” on unit root probability value punitroot(q, N = Inf, trend = c("c", "nc", "ct", "ctt"), statistic = c("t", "n"), na.rm = FALSE) To my knowledge, “c” means “const” or intercept, “nc” means no const or intercept, and “ct” means time trend

Hi All. I'd like to change the default plotting colors used to construct a scatterplot with regression line in the CAR package. So, scatterplot(y~pred,smooth=FALSE, xlab="X", ylab="Y", lwd=2) If I change the palette (e.g., palette(ranbow(6)), I can change the color of the lines and points. However, the axes and labels remain in black (i.e., the first color in the

I am trying to use scatterplot function in CAR like the following: scatterplot(X~Y) I want to label X points and Y ponits using the different color. Any idea for this? Aimin

Hello R folks, I am encountering a problem with the following scatterplot function from the car package: > scatterplot(y~x|z) where y and x are continuous (interval) random variables and z is a categorical variable. When z is a categorical variable coded 1 or 2, I (appropriately) get a scatterplot of y by x, coded by z. Similarly, when z is a categorical variable coded 1, 2, or 3, there is

hi, new to R and using the car package to do some scatterplots with ellipses hoping to add the area and center points of each ellipse to the legend? looking for some direction / ideas.... here is the script, the data is where golf shots end up by club. x (dispersion), y (distance), group (Club) thanks, sam ## usage: Rscript shotScatter.R infile outfile level1 level2 minX maxX minY maxY

Network Blitz I'm trying to generate a graph to summarize Interest Rate Parity. This involves a scatterplot of x against y where the x and y limits are set so to center the graph on 0,0 and then adding each axis line and a 45 degree line. Using CAR's scatterplot (sample code below) everything except the axes plot fine: scatterplot( Interest.Rate.Dif ~ ForPrm| profit,

Hello all! System: R2.0.1, W2k. All packages apdated with update.packages(). I use the default graphic device for my system (no active choice). I?m trying to fine-tune scatterplot() graphs (package car), for publication. I want to control plotting symbols and colours to match plots from other, less flexible, systems. I also need to make all text and symbols bigger, to enable printing of the

I am getting an error message from scatterplot: > library(car) > scatterplot(Prestige$income~Prestige$type) Error in Summary.factor(c(2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, : range not meaningful for factors In addition: Warning message: In Ops.factor(x[floor(d)], x[ceiling(d)]) : + not meaningful for factors > The command does output the kind of graph that I want (boxplots).