Displaying 20 results from an estimated 900 matches similar to: "scatterplot in Package CAR"
2011 Mar 15
2
graph lines don;t appear
Hi
I am trying to plot two simple graphs with a grid in background. The axis
and grid appears in correct position, but the actual data are not there....
Can somebody provide me a hint what is missing?
The code is:
pln <- read.table(file="PLN.txt", header=TRUE, dec=",")
par(mfrow=c(1,2))
plot(pln[,1], type="l", lwd="2", ylab="EUR/PLN",
2018 May 15
2
questions on subscores.
Hello,
I want to compute Wainer et al's augmented subscore(2001) using IRT but I can't find any packages or relevant code.
There is a 'subscore' package in R, but I think it only gives functions to calculate augmented subscores using CTT(classical test theory).
Is there other package or code to compute subscores using IRT? If it is not, is there any plan to develop it in
2008 Dec 26
3
Simulating dataset using Parallel Latent CTT model?
I am trying to simulate a dataset using Parallel Latent CTT model and this is what i have done so far:
(START)
#Importing psych library for all the simulation related functions
library(psych)
# Settting the working directory path to C:/NCME
path="C:/NCME"
setwd(path)
#Using the function to generate the data
GenData <- congeneric.sim(N=500, loads =
2018 May 15
0
questions on subscores.
I have no idea, but Google pointed me to this
https://cran.r-project.org/web/packages/subscore/index.html
Hth
Ulrik
"Hyunju Kim" <asdfg4882 at yonsei.ac.kr> schrieb am Di., 15. Mai 2018, 07:21:
>
>
>
> Hello,
>
>
>
> I want to compute Wainer et al's augmented subscore(2001) using IRT but I
> can't find any packages or relevant code.
>
>
2013 Feb 14
1
fill colour in grid
Dear all r-users,
I have this code below to draw two squares, small and big square. I would like to colour the small square with red and the big square with blue for example. I tried using polygon but fail. Thank you so much for your help.
par(mar=c(4,4,2,1.2),oma=c(0,0,0,0),xaxs="i", yaxs="i")
plot.new()
plot.window(xlim= c(0,8),
2009 Dec 08
1
histbackback function
Hi,
I'm trying to recreate a sensitivity-specificity graph using the
histbackback function. The only problem is that these graphs are typically
drawn with vertical rather than horizontal bar plots (and the histbackback
function only seems to work with horiz=TRUE argument, using "horiz=FALSE"
doesn't work). Does anyone know if:
1) there's a different graphing function that
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2009 Jan 28
1
stack data sets
Hi All,
I'm generating 10 different data sets with 1 and 0 in a matrix form and writing the output in separate files. Now I need to stack all these data sets in one vector and I know that stack only operates on list or data frame however I got these data sets by converting list to a matrix so can't go backwards now. Is there a way i can still use Stack?
Please see the program:
2008 Apr 02
0
Using file to handle a direcoty, recurse question.
Alright, going ot ask this question in advance of doing bone headed
tests. I have one application that does not understand the idea of
/usr/local/ and insists on populating /usr. Of course it is closed
source and commercial and it is the one they want to use. Below is the
list of junk it shoves in /usr/share. Between the Type Reference guide
and another email , I believe I can move this tree
2002 Sep 16
2
TclTk Again
Dear All,
Following Zhang instructions I add the environmental variables, but now I
receive the following message:
> library(tcltk)
Error in firstlib(which.lib.loc, package) :
Can't find a usable init.tcl in the following directories:
{ C:\tcl\lib\tcl8.3}
This probably means that Tcl wasn't installed properly.
Error in library(tcltk) : .First.lib failed
I'm using R Win
2005 Jun 28
2
axTicks on a reverse ylog plot (PR#7973)
There is still issues with the reversed y-log scale plot:
# Test case A: works as expected
plot(10:100,log="y",ylim=c(100,11))
grid()
par("yaxp")
# Test case B: grid does not have horizontal lines; par("yaxp") is
different
plot(1:100,log="y",ylim=c(100,10))
grid()
par("yaxp")
In the second test case, axTicks for the horizontal lines (in
2009 Mar 10
3
reliability, scale scores in the psych package
Dear Professor Revelle and R-helpers,
This is a two-part question: the first part is general, and the second
is specific to the psych package.
First question: In the past I've constructed composite variables from
questionnaire data by using rowMeans(), and then correlating items
with the scale using cor() as an informal check for "bad" items. Over
the weekend I decided to take a
2012 Feb 07
0
A question on p-value of Unit Root Tests using “urca” toolbox
A question on p-value of Unit Root Tests using “urca” toolbox
There’s a function “punitroot” on unit root probability value
punitroot(q, N = Inf, trend = c("c", "nc", "ct", "ctt"), statistic = c("t",
"n"), na.rm = FALSE)
To my knowledge, “c” means “const” or intercept, “nc” means no const or
intercept, and “ct” means time trend
2006 Feb 01
1
Scatterplot color options in CAR package?
Hi All.
I'd like to change the default plotting colors used to construct a
scatterplot with regression line in the CAR package.
So,
scatterplot(y~pred,smooth=FALSE, xlab="X", ylab="Y", lwd=2)
If I change the palette (e.g., palette(ranbow(6)), I can change the color of
the lines and points.
However, the axes and labels remain in black (i.e., the first color in the
2008 Feb 11
1
scatterplot in CAR
I am trying to use scatterplot function in CAR like the following:
scatterplot(X~Y)
I want to label X points and Y ponits using the different color.
Any idea for this?
Aimin
2010 Apr 25
1
categorical variable in scatterplot (car)
Hello R folks,
I am encountering a problem with the following scatterplot function from the
car package:
> scatterplot(y~x|z)
where y and x are continuous (interval) random variables and z is a
categorical variable. When z is a categorical variable coded 1 or 2, I
(appropriately) get a scatterplot of y by x, coded by z. Similarly, when z
is a categorical variable coded 1, 2, or 3, there is
2009 Jun 09
1
scatterplot (car) legend modification
hi,
new to R and using the car package to do some scatterplots with ellipses
hoping to add the area and center points of each ellipse to the legend?
looking for some direction / ideas.... here is the script, the data is
where
golf shots end up by club.
x (dispersion), y (distance), group (Club)
thanks, sam
## usage: Rscript shotScatter.R infile outfile level1 level2 minX maxX
minY maxY
2002 Aug 26
1
(CAR) Scatterplot and problems (?) with abline
Network Blitz
I'm trying to generate a graph to summarize Interest Rate Parity. This
involves a scatterplot of x against y where the x and y limits are set
so to center the graph on 0,0 and then adding each axis line and a 45
degree line. Using CAR's scatterplot (sample code below) everything
except the axes plot fine:
scatterplot( Interest.Rate.Dif ~ ForPrm| profit,
2005 Jan 14
1
Fine tuning scatterplot() (car package)
Hello all!
System: R2.0.1, W2k.
All packages apdated with update.packages().
I use the default graphic device for my system (no active choice).
I?m trying to fine-tune scatterplot() graphs (package car), for
publication.
I want to control plotting symbols and colours to match plots from
other, less flexible, systems. I also need to make all text and
symbols bigger, to enable printing of the
2011 Jan 14
1
Question about scatterplot in package car
I am getting an error message from scatterplot:
> library(car)
> scatterplot(Prestige$income~Prestige$type)
Error in Summary.factor(c(2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, 2L, :
range not meaningful for factors
In addition: Warning message:
In Ops.factor(x[floor(d)], x[ceiling(d)]) : + not meaningful for factors
>
The command does output the kind of graph that I want (boxplots).