similar to: Help with SVM package Kernlab

Hi All, I am trying to use the "Kernlab" package for training and prediction using SVM's. I am getting the following error when I am trying to use the predict function: > predictSvm = predict(modelforSVM, testSeq); Error in `contrasts<-`(`*tmp*`, value = "contr.treatment") : contrasts can be applied only to factors with 2 or more levels The training file is a

Hi! The kernlab function kpca() mentions that new observations can be transformed by using predict. Theres also an example in the documentation, but as you can see i am getting an error there (As i do with my own data). I'm not sure whats wrong at the moment. I haven't any predict functions written by myself in the workspace either. I've tested it with using the matrix version and the

Hi!! I am trying to figure out how to use the string kernel "stringdot" in kernlab. k <- function(x,y) { (sum(x*y) +1)*exp(-0.001*sum((x-y)^2)) } class(k) <- "kernel" data(promotergene) ## train svm using custom kernel gene.k <- ksvm(Class~.,data=promotergene,kernel=k,C=10,cross=5) # works fine in this case gene.rbf <-

hi, I am using R's "kernlab" package, exactly i am doing classification using ksvm(.) and predict.ksvm(.).I want use of custom kernel. I am getting some error. # Following R code works (with promotergene dataset): library("kernlab") s <- function(x, y) { sum((x*y)^1.25) } class(s) <- "kernel" data("promotergene") gene <- ksvm(Class ~ .,

Hello, I'm trying to using ksvm() in the kernlab package to fit a one-class SVC, but I get a strage result on the cross-validation error estimate. For example, consider this code: data(spam) classifier <- ksvm(type~.,data=spam[which(spam[,'type']=='spam'),], type="one-svc",kernel="rbfdot",kpar=list(sigma=0.1),nu=0.05,cross=10) what I get is: >

Hello, I would like to know, whether for the support vector classification function ksvm() the response values stored in object at ymatrix are cross validated outputs/predictions: Example code from package kernlab, function ksvm: library(kernlab) ## train a support vector machine filter <- ksvm(type~.,data=spam,kernel="rbfdot",kpar=list(sigma=0.05),C=5,cross=3) filter filter at

Hi, A. In a nutshell: The training error, obtained as "error (ret)", from the return value of a ksvm () call for a eps-svr model is (likely) being computed wrongly. "nu-svr" and "eps-bsvr" suffer from this as well. I am attaching three files: (1) ksvm.R from the the kernlab package, un-edited, (2) ksvm_eps-svr.txt: (for easier reading) containing only eps-svr

Hi everybody, I''m using R on a 64-bit Ubuntu 9.04 (Jaunty). I prefer to install R packages from source, even if they are available in Synaptic. The problem is that I can''t install/compile kernlab. Everything works fine until it gets to the lazy loading part: ** preparing package for lazy loading Creating a new generic function for "terms" in "kernlab"

Hi, I have a process using svm from the e1071 library. it works. I want to try using the KSVM library instead. The same data used wiht e1071 gives me an error with KSVM. My data is a data.frame. sample code: svm_formula <- formula(y ~ a + B + C) svm_model <- ksvm(formula, data=train_data, type="C-svc", kernel="rbfdot", C=1) I get the following error:

Hi Abbas, Before I try to give you answers, I just want to mention that you should send R related reqests to the R-help list, and not me personally because (i) there's a greater likelihood that it will get answered in a timely manner, and (ii) people who might have a similar problem down the road might benefit from any answer via searching the list archives ... anyway: On Sep 5, 2009, at

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

with pred.pca<-predict(splits[[i]]$pca,trainingData at samples)[,1:nPCs] dframe<-as.data.frame(cbind(pred.pca,class=isExplosive(trainingData,2))); results[[i]]$classifier<-ksvm(class~.,data=dframe,scaled=T,kernel="polydot",type="C-svc", C=C,kpar=list(degree=degree,scale=scale,offset=offset),prob.model=T) and a degree of 5 i get an error of 0 reported by the ksvm

I'm using caret to assess classifier performance (and it's great!). However, I've found that my results differ between R2.* and R3.* - reported accuracies are reduced dramatically. I suspect that a code change to kernlab ksvm may be responsible (see version 5.16-24 here: http://cran.r-project.org/web/packages/caret/news.html). I get very different results between caret_5.15-61 +

Hi! If i found a problem with the code of one of the libraries (not core), or, in my current case, would wish something minor changed for convenience, where can i get contact? Can i put it in the "official" bug repository? (Problem discription for anyone interested: Why call the default function kpca for a matrix with kpar=list(sigma=0.2), instead of putting this default sigma into the

Hello useRs! So, I have a random question. I'm trying to build a character string, then evaluate it. I think an example would be the easiest way to explain: kern.vec = c("rbfdot","polydot") for( j in 1:length( kern.vec ) ) { formula = paste("ksvm( ind ~ . , data=d.temp[,c(ind_col,dep_cols)], kernel =",kern.vec[j],", prob.model=T

Hi, I tried to load the package "kernlab" under R-v11 and R-v10, however it gave error message: Error in library.dynam(lib, package, package.lib) : shared library 'kernlab' not found In addition: Warning message: package 'kernlab' was built under R version 2.12.0 Error: package/namespace load failed for 'kernlab' Has anybody loaded this successfully before?

HI I am new to R. I have one problem in the predict function of the kernlab. I want to use ksvm and predict with kernelmatrix (S4 method for signature 'kernelMatrix') #executing the following sentences library(kernlab) # identity kernel k <- function(x,y) { n<-length(x) cont<-0 for(i in 1:n){ if(x[i]==y[i]){ cont<-cont+1 } } cont } class(k) <-

Dear R users, I have recently encountered a problem with using the function `library` in order to load the package `kernlab`. My output of sessionInfo() is as follows: R version 2.10.1 (2009-12-14) x86_64-unknown-linux-gnu locale: [1] C attached base packages: [1] stats graphics grDevices utils datasets methods base I have installed the package by

Hi, this is a question about the R package kernlab. I use kernlab as a library in a C++ program. The host application defines a graph kernel (defined by me), generates a gram matrix and trains kernlab directly on this gram matrix, like this: regm<-ksvm(K,y,kernel="matrix"), where K is the n x n gram kernelMatrix of my kernel, and y is the R-vector of quantitative target values.

Dear all, I was wondering if someone can help me. I am learning SVM for classification in my research with kernlab package. I want to know about classification performance using Area Under Curve (AUC). I know ROCR package can do this job but I found all example in ROCR package have include prediction, for example, ROCR.hiv {ROCR}. My problem is how to produce prediction in SVM and to find