similar to: xyplot key

I'm new to H.323 and I have noticed that there are two separate channel drivers for * available - the inbuilt one, and oh-323. I had trouble compiling oh-323 with the current cvs stable, so I tried the inbiult one (with specifiec recommended versions of openh323 and pwlib). It compiled cleanly but I am told that it is not recommended (unstable?). Can someone with first-hand * H.323

Dear friends - windows R 3.3.3 - sorry to ask a simple question - but I cannot make setwd work properly in scripts In the example below I have made a directory in C (firstdir) and a directory in that (secdir) and the intention is to change directory to the second from the first - it works when I put the entire path but not the tilde - what am I missing? I was around rwf 2.14 as per the help

In R version 2.6.1 (2007-11-26) and R version 2.6.1 Patched (2008-01-19 r44061) on openSUSE 10.2 (X86-64) > gctorture() > proc.time() Error: protect(): protection stack overflow The problem with this is that then R CMD check --use-gct foo ALWAYS FAILS with > cat("Time elapsed: ", proc.time() - get("ptime", pos = 'CheckExEnv'),"\n") Error in

Good afternoon, My goal is to warn the user any time that they use the `require' function. The reason is that they probably wanted to use `library' instead. There is a case where they should use the former though, so I just want to issue a warning. My approach was to: ? Re-bind `require' to `original.require' ? Re-implement `require' to ? Warn the user ? Delegate the real

Signed-off-by: Allen Pais <allen.lkml at gmail.com> --- arch/powerpc/platforms/cell/spider-pci.c | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/arch/powerpc/platforms/cell/spider-pci.c b/arch/powerpc/platforms/cell/spider-pci.c index d1e61e2..82aa3f7 100644 --- a/arch/powerpc/platforms/cell/spider-pci.c +++ b/arch/powerpc/platforms/cell/spider-pci.c @@ -106,7 +106,7

Current core/Recommended Matrix package (0.999375-48) has been segfaulting against R 2.13-alpha/2.14-trunk for the last week or so (since R-2.13 was branched, when I started trying) when "run with R CMD check --use-gct": -------------- > pkgname <- "Matrix" > source(file.path(R.home("share"), "R", "examples-header.R")) >

Found the simpliest way of seeing I bug I encountered doing "R CMD check --use-gct": Just launch R (with --vanilla), and do this: > ?gctorture # this work > gctorture() > ?gctorture Error in gzfile(file, "rb") : can only weakly reference/finalize reference objects # this does not It seems that when gctorture() is on gzfile() doesn't work.

Hi, Today I got curious about whether or not I /could/ remove `attach' from my system so: - Backed it up - Implemented a new one - Like this ,---- | attach.old <<- attach | attach <<- function(...) {stop("NEVER USE ATTACH")} `---- I got the error: ,---- | Error: cannot change value of locked binding for 'attach' `---- If I unlock `attach' I assume that I

On Wed, 23 Nov 2016 16:04:22 -0600 (CST) Greg Rivers <gcr+dovecot at tharned.org> wrote: > On Wed, 23 Nov 2016, Steve Litt wrote: > > [snip] > > > > Alpine still gives me a bad cert warning, saying I should either > > fix it or disable checking. I haven't yet found a way to get Alpine > > to discriminate between a valid self-signed cert and a bad one.

Dear Deepayan and dear list, I notice a small inconsistency with the command completion of the R CMD check. --no-latex is deprecated sincs R 2.12.0 and defunct since 2.13.0 but the command line completion still suggests it: cb at cbdesktop:~/r-devel$ bin/R CMD check --no-<here I hit tab> --no-clean --no-examples --no-latex --no-vignettes --no-codoc --no-install

Dear Deepayan and dear list, I notice a small inconsistency with the command completion of the R CMD check. --no-latex is deprecated sincs R 2.12.0 and defunct since 2.13.0 but the command line completion still suggests it: cb at cbdesktop:~/r-devel$ bin/R CMD check --no-<here I hit tab> --no-clean --no-examples --no-latex --no-vignettes --no-codoc --no-install

Good afternoon, Today I was working on a practice problem. It was simple, and perhaps even realistic. It looked like this: ? Get a list of all the data files in a directory ? Load each file into a dataframe ? Merge them into a single data frame Because all of the columns were the same, the simplest solution in my mind was to `Reduce' the vector of dataframes with a call to `merge'. That

I'm trying to network-boot a GCT Allwell set-top box without success. My frustration level is high. The problem seems to be that the Allwell is sending a RRQ with an option. tftp-hpa responds with an OACK, and waits for the corresponding ACK from the Allwell. The Allwell never sends that ACK, but instead continues with the same RRQ until timeout. Having read RFC1782, this makes me think

On Thu, 24 Nov 2016 07:52:51 +0100 (CET) Steffen Kaiser <skdovecot at smail.inf.fh-brs.de> wrote: > -----BEGIN PGP SIGNED MESSAGE----- > Hash: SHA1 > > On Wed, 23 Nov 2016, Steve Litt wrote: > > >On Wed, 23 Nov 2016 16:04:22 -0600 (CST) Greg Rivers > ><gcr+dovecot at tharned.org> wrote: > >> $ strings $(whence alpine) | grep '^/.*certs$'

Hello, I was wondering whether there is a possobility to add File types to the list of filters known by R. I'm using the function choose.files in Windows. I have some files I always use and i would like to filter my option to these kind of files. I have some "atr", "cdt", "gct", "gmt" etc. Is there a way of telling R to filter only these files?

Hello r-help, I try to fit birds counts over years using glm. I have done (with Estate and year as factors): Model1 <- glm(Females~Estate+Year+offset = log(area)), family = quasipoisson(link = log), na.action = "na.exclude") After I have calculated the prediction using: Pred1 <- predict(Model1, type = "response", na.action = "na.exclude") My question

Hi, I'm currently having some problem connect .mdb file into R. I've installed the RODBC packages and I do the code this way: channel <- odbcConnectAccess("C:/Users/Documents/XYZ") channel and it gave me this : RODBC Connection 3 Details: case=nochange DBQ=C:\USers\JieYi\Documents\NYP\IPP\GCR Driver={Microsoft Access Driver (*.mdb)} DriverId=25 FIL=MS Access

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >

I have tried without success to find a way including the square root symbol in lattice strips as part of my conditioning labels. I have tried supplementing by creating a list of vectors using the var.name function coupled with the expression function used in xlab/ylab. xyplot(adjusted_Rand_index~cluster|distance_measure, main="Level of agreement between partitions: Wards Method",

Hi all, can anyone suggest a reason as mto why my xlab is plotting this text at oposite ends of axis. I would like to represent my lable like this: Moran's I ...but with the I in italics. For some reason they seperate and position at oposite ends of the axis?? Thank you library(lattice) dat <- data.frame(x = rnorm(10),y = rnorm(10)) xyplot(y ~ x, dat,xlab=expression("Moran's