search for: utpalmtbi

...ply(2:ncol(dat2),function(i) {x1<- combn(names(dat2),i);unlist(lapply(1:ncol(x1), function(i) {x2<- dat2[,x1[,i]];dim(x2[!as.logical(rowSums(x2==0)),])[1]}))}) res #[[1]] #[1] 6 7 6 6 5 6 #[[2]] #[1] 6 5 6 5 # #[[3]] #[1] 5 A.K. ________________________________ From: Utpal Bakshi <utpalmtbi at gmail.com> To: arun <smartpink111 at yahoo.com> Sent: Saturday, March 2, 2013 2:14 PM Subject: Re: explanation of the problem.. may be you could use the specaccum function of vegan package for permutations.. the function is shown in pan genome script file.. On Sun, Mar 3, 2013 at...

Hi all, I have a sequence file (fasta format) and want to calculate the rho statistics for dinucleotide abundance value on my data.. the code which I use is (using seqinr library and current working directory) seq_info<-read.fasta("gene.txt") rho(seq_info[1],2) but it yields only the dinucleotides, not their rho values, i.e, > rho(seq_info[1],2) aa ac ag at ca cc cg ct ga gc

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789