search for: utpal

....google.com/document/d/1QyUzL3OOwJSI91lDqr7VsvqUsFyTY9FlpAwbGSipUtw/edit>" as my project for this years GSoC. The broad idea is to provide an API to Polly's dependence framework and integrate it to Loop Vectorizer. Kindly share your thoughts and help me improve the proposal. Regards, Utpal Bora Ph.D. Scholar +917032002001 Computer Science & Engineering IIT Hyderabad -------------- next part -------------- An HTML attachment was scrubbed... URL: <http://lists.llvm.org/pipermail/llvm-dev/attachments/20160324/b6fa2741/attachment.html>

Hi Utpal, This is a nice proposal :) Can you submit it through the GSoC interface please? I don't see it in the list of applications. Note that the deadline for the final submission is Friday 7pm UTC. Best, -- Mehdi > On Mar 23, 2016, at 1:12 PM, Utpal Bora via llvm-dev <llvm-dev at lists.llv...

...ready the active version in easy-install.pth* *Installed /home/xxx/xxx/workBox/lib/python2.7/site-packages/six-1.8.0-py2.7.egg* *error: Could not find required distribution six==1.9.0* *When I run lnt, I am getting the following error-* *pkg_resources.DistributionNotFound: six==1.9.0* Regards, Utpal Bora Ph.D. Scholar Computer Science & Engineering IIT Hyderabad http://utpalbora.com -------------- next part -------------- An HTML attachment was scrubbed... URL: <http://lists.llvm.org/pipermail/llvm-dev/attachments/20160825/81894aa8/attachment.html>

Hello Tim, Thank you for the information. I am wondering if anyone else is facing the same issue? Or it is just that my institute firewall is creating the problem. Regards, Utpal Bora Ph.D. Scholar +917032002001 Computer Science & Engineering IIT Hyderabad On Sun, Mar 20, 2016 at 10:14 PM, Tim Northover <t.p.northover at gmail.com> wrote: > Hi Uptal, > > On 20 March 2016 at 01:06, Utpal Bora via llvm-dev > <llvm-dev at lists.llvm.org> wrote: &...

Hi All, git is running very slow for me while cloning from llvm.org/git/llvm.git while it is reasonably fast for me cloning from github.com/llvm-mirror/llvm.git Please suggest which repo is used by most developers or what alternative I can use? Regards, Utpal Bora Ph.D. Scholar +917032002001 Computer Science & Engineering IIT Hyderabad -------------- next part -------------- An HTML attachment was scrubbed... URL: <http://lists.llvm.org/pipermail/llvm-dev/attachments/20160320/747ed146/attachment.html>

...rfaces like isParallel(), isVectorizable(), tripCount(Loop&). Please feel free to post your comments and suggestions on this. [1] https://docs.google.com/document/d/1QyUzL3OOwJSI91lDqr7VsvqUsFyTY9FlpAwbGSipUtw/edit# [2] https://groups.google.com/forum/#!topic/polly-dev/DuRxNmKfEnM Regards, Utpal Bora Ph.D. Scholar Computer Science & Engineering IIT Hyderabad -------------- next part -------------- An HTML attachment was scrubbed... URL: <http://lists.llvm.org/pipermail/llvm-dev/attachments/20160507/4d4a421e/attachment.html>

...hen the other analysis engines fail to provide a concrete result. I do not want to overestimate things by proposing such a common framework for Dependence analysis in LLVM. The integration will not be tight as we can return empty analysis result if Polly is not compiled with LLVM tools. Regards, Utpal Bora Ph.D. Scholar +917032002001 Computer Science & Engineering IIT Hyderabad On Fri, Mar 25, 2016 at 7:53 AM, Hongbin Zheng <etherzhhb at gmail.com> wrote: > In the design the LLVM passes always directly communicate with PolyhedralInfo, > this requires Polly tightly integrate in...

..., D21486 <http://reviews.llvm.org/D21486> I thank Johannes, Tobias, Michael, Ether and others for all the support/feedback/advises. Especially, Johannes for the time spent in hangouts, which we have been having two times a week. Looking forward for your suggestions and comments. Regards, Utpal Bora Ph.D. Scholar Computer Science & Engineering IIT Hyderabad http://utpalbora.github.io -------------- next part -------------- An HTML attachment was scrubbed... URL: <http://lists.llvm.org/pipermail/llvm-dev/attachments/20160620/380cbd4a/attachment.html>

HI Utpal, Alight, I will look into it.? I was under the impression that this is what you wanted: dat1<- structure(list(V1 = c(1L, 1L, 1L, 1L, 1L, 1L, 1L), V2 = c(1L, 1L, 1L, 1L, 1L, 1L, 0L), V3 = c(1L, 1L, 1L, 1L, 1L, 1L, 1L), ??? V4 = c(1L, 1L, 0L, 1L, 1L, 1L, 1L), V5 = c(1L, 1L, 1L, 1L, ??? 1L, 0L, 1...

On 03/23, Hongbin Zheng wrote: > Hi Johannes, > > On Mon, Mar 21, 2016 at 6:35 PM, Johannes Doerfert < > doerfert at cs.uni-saarland.de> wrote: > > > Hey Utpal, > > > > First of, I think you made nice process here and have some very good > > ideas of what we could do in the future. > > > > [NOTE: I CC'ed some people that have shown interest in this topic but I > > might have forgotten some, therefor I also added the...

Hey Utpal, First of, I think you made nice process here and have some very good ideas of what we could do in the future. [NOTE: I CC'ed some people that have shown interest in this topic but I might have forgotten some, therefor I also added the llvm-dev list.] For the upcoming GSoC proposal we should...

...read.fasta("gene.txt") rho(seq_info[1],2) but it yields only the dinucleotides, not their rho values, i.e, > rho(seq_info[1],2) aa ac ag at ca cc cg ct ga gc gg gt ta tc tg tt I will be grateful if anyone solve this.. I've also attached the sequence file.. Thanks in advance.. Utpal -- View this message in context: http://r.789695.n4.nabble.com/rho-stat-from-a-fasta-sequence-file-tp4298621p4298621.html Sent from the R help mailing list archive at Nabble.com.

...2016 at 5:05 PM, Johannes Doerfert < doerfert at cs.uni-saarland.de> wrote: > On 03/23, Hongbin Zheng wrote: > > Hi Johannes, > > > > On Mon, Mar 21, 2016 at 6:35 PM, Johannes Doerfert < > > doerfert at cs.uni-saarland.de> wrote: > > > > > Hey Utpal, > > > > > > First of, I think you made nice process here and have some very good > > > ideas of what we could do in the future. > > > > > > [NOTE: I CC'ed some people that have shown interest in this topic but I > > > might have forgotten s...

...feasible to provide a common interface for different loop dependence analyses like alias analysis, such that passes like LoopVectorizer/LoopLoadElimination/LoopDistribution etc. can query loop dependency information from different implementations for precision/compile-time trade off? I ask because Utpal proposed to introduce dependency information calculated by Polly to LoopVectorizer. And I am interested in building a common interface for loop dependence analyses. Thanks Hongbin > > -------------- next part -------------- An HTML attachment was scrubbed... URL: <http://lists.llvm.org...

Hi Johannes, On Mon, Mar 21, 2016 at 6:35 PM, Johannes Doerfert < doerfert at cs.uni-saarland.de> wrote: > Hey Utpal, > > First of, I think you made nice process here and have some very good > ideas of what we could do in the future. > > [NOTE: I CC'ed some people that have shown interest in this topic but I > might have forgotten some, therefor I also added the llvm-dev list.] > > For...

> On Mar 22, 2016, at 5:13 PM, Philip Reames <listmail at philipreames.com <mailto:listmail at philipreames.com>> wrote: > > > > On 03/20/2016 05:38 AM, Aries Gunawan via llvm-dev wrote: >> Hi everyone, >> >> I am very interested in contributing to LLVM project in this year’s GSoC. I am new with LLVM, but this is used in the compiler course in my

...am able to connect to the vcenter server using virsh tool. 4. However i am not able to connect using libvirt java program. The issue it seems that virt library cannot be found. (Sample output attached). The question is how do i get libvirt.dylib on my mac. Any pointers would be really helpful Re, Utpal Exception in thread "main" java.lang.UnsatisfiedLinkError: Unable to load library 'virt': Native library (darwin/libvirt.dylib) not found in resource path

...eev, SaleemAbdulrasool, Sameer Sahasrabuddhe, Sanjoy Das, Sameer AbuAsal, SamNovak, Sebastian Pop, Siddharth Bhat, Singapuram Sanjay Srivallabh,Sumanth Gundapaneni, Sunil Srivastava, Sylvestre Ledru, Star Tan, TanyaLattner, Tim Shen, Tarun Ranjendran, Theodoros Theodoridis, Utpal Bora,Wei Mi, Weiming Zhao, and Yabin Hu.* -- Hal Finkel Lead, Compiler Technology and Programming Languages Leadership Computing Facility Argonne National Laboratory

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789

...srabuddhe, Sanjoy Das, Sameer AbuAsal, > > SamNovak, Sebastian Pop, Siddharth Bhat, Singapuram Sanjay > > Srivallabh,Sumanth Gundapaneni, Sunil Srivastava, Sylvestre Ledru, Star > > Tan, TanyaLattner, Tim Shen, Tarun Ranjendran, Theodoros Theodoridis, > > Utpal Bora,Wei Mi, Weiming Zhao, and Yabin Hu.* > > > > -- > > Hal Finkel > > Lead, Compiler Technology and Programming Languages > > Leadership Computing Facility > > Argonne National Laboratory > > > > > >...