search for: unconcaten

Displaying 1 result from an estimated 1 matches for "unconcaten".

Did you mean: concaten
2010 Jan 26
4
reading a string vector
Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context: http://n4.nabble.com/reading-a-string-vector-tp1290289p1290289.html Sent from the R help mailing list archive at Nabble.com. [[alternative HTML version deleted]]