search for: uco

...In$xorig, y1=datIn$lcs, ,angle=90, code=3, length=0.1 ) mtext("Fechas", side=1, line=1, outer=T) #--------------------------- <Rplot.png> Saludos, Carlos Ortega www.qualityexcellence.es El 8 de septiembre de 2014, 10:57, Carlos Fernández-Delgado <ba1fedec en uco.es> escribió: Muchas gracias Carlos, previo a mi correo, entre las pruebas que hice estaba una parecida a la que apuntas de la siguiente manera: attach (Libro1) plot (xbar~as.Date(fechas,"%d/%m/%y"), ylim=c(400,660), xaxt="n", type="b", pch=19,cex=1) xlabels&...

...t;at") y qué quieres incluir en la marca (parámetro "label"). Para ver un ejemplo, mira el ejemplo que aparece en la ayuda de la función "axis()". Saludos, Carlos Ortega www.qualityexcellence.es El 7 de septiembre de 2014, 20:46, Carlos Fernández-Delgado <ba1fedec en uco.es> escribió: Estimada Comunidad, solicito vuestra ayuda en un tema quizás un poco tonto, pero no logro dar con la tecla. Estoy intentando hacer una gráfica de la evolución temporal de una variable (xbar) a lo largo del tiempo. La secuencia que he hecho es la siguiente: attach(Libro1) plot (xbar...

I'm running beta7 on two machines, with maildir on NFS. I have lockd running on all machines. I've found that Dovecot is highly unstable with NFS when accessing a mailbox on more than one machine at the same time. Both dovecot machines have: mmap_disable = yes lock_method = fcntl NFS is version 3, exported from a third linux machine. All machines are running 2.6.9 kernel. Any ideas

...wrong flags. */ that looks like a clue. It happens with CVS versions 20060320 and 20060325 I hace done almost all tests with Thunderbird. Best regards. -- +----------------------------------------------^-----------------------+ | Luis Mel?ndez Aganzo ^ Email: luism at uco.es | | Servicio de Inform?tica ^ Tlf: 34-(9)57-211022 | | ?rea de Sistemas ^ Fax: 34-(9)57-218116 | | Universidad de C?rdoba (SPAIN) ^ http://www.uco.es | +----------------------------------------------^-----------------------+

Is it possible to use Dovecot frontends in front of UWash backends? I need a proxy pool ASAP. There is not sufficient time to migrate the backends for 40,000+ users so they have to stay UW for now. I have been looking at Perdition but concerned about performance under load. Dovecot looks really promising with it's non-forking mode. I need simple dumb frontends no local mail. Other

...e of replacement length Thanks Armando Ferreira ---------------------------------------------------------------------------- ------------- Armando Mateus Ferreira Escuela Técnica Superior de Inginieros Agrónomos y Montes Universidad de Córdoba-España Avda. Menendez Pidal, 14080 Córdoba td2mafea@uco.es Escola Superior Agrária 6000 Castelo Branco-Portugal armando@esa.ipcb.pt -.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.- r-devel mailing list -- Read http://www.ci.tuwien.ac.at/~hornik/R/R-FAQ.html Send "info", "help", or "[un]subscribe...

...t;at") y qué quieres incluir en la marca (parámetro "label"). Para ver un ejemplo, mira el ejemplo que aparece en la ayuda de la función "axis()". Saludos, Carlos Ortega www.qualityexcellence.es El 7 de septiembre de 2014, 20:46, Carlos Fernández-Delgado <ba1fedec en uco.es> escribió: Estimada Comunidad, solicito vuestra ayuda en un tema quizás un poco tonto, pero no logro dar con la tecla. Estoy intentando hacer una gráfica de la evolución temporal de una variable (xbar) a lo largo del tiempo. La secuencia que he hecho es la siguiente: attach(Libro1) plot (xbar...

...en reverse translate this at the nucleic acid level from a clustalw output. This can be done on the fly if clustalw is available on your platform. http://pbil.univ-lyon1.fr/software/SeqinR/SEQINR_CRAN/DOC/html/reverse.align.html o An undocumented behavior was reported by Guy Perriere for uco() when computing RSCU on sequences where an amino-acid is missing. There is now a new argument NA.rscu that allows the user to force the missing values to his favorite magic value. http://pbil.univ-lyon1.fr/software/SeqinR/SEQINR_CRAN/DOC/html/uco.html o There was a bug in read.fasta(...

...en reverse translate this at the nucleic acid level from a clustalw output. This can be done on the fly if clustalw is available on your platform. http://pbil.univ-lyon1.fr/software/SeqinR/SEQINR_CRAN/DOC/html/reverse.align.html o An undocumented behavior was reported by Guy Perriere for uco() when computing RSCU on sequences where an amino-acid is missing. There is now a new argument NA.rscu that allows the user to force the missing values to his favorite magic value. http://pbil.univ-lyon1.fr/software/SeqinR/SEQINR_CRAN/DOC/html/uco.html o There was a bug in read.fasta(...

...st: Jul 07 15:00:48 auth: Debug: master in: PASS 1 user56 at domain.de service=lmtp lip=::1 lport=30025 rip=::1 rport=41992 Jul 07 15:00:48 auth: Debug: ldap(user56 at domain.de,::1): pass search: base=ou=mailboxes,ou=vfag,c=de,o=top scope=subtree filter=(&(objectClass=uco)(mail=user56 at domain.de)) fields=mailboxname,userpassword,myproxy Jul 07 15:00:48 auth: Debug: auth(user56 at domain.de,::1): username changed user56 at domain.de -> 1000000000032 Jul 07 15:00:48 auth: Debug: ldap(1000000000032,::1): result: mailboxname(user)=1000000000032 userpassword(pass...

...lled the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... > uco(newdata5,index="rscu") aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag cat NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA cca ccc ccg cct cga cgc cgg cgt cta ctc ctg ctt gaa gac gag gat gca gcc gcg gct NA NA NA NA NA NA...

Estimada Comunidad, solicito vuestra ayuda en un tema quizás un poco tonto, pero no logro dar con la tecla. Estoy intentando hacer una gráfica de la evolución temporal de una variable (xbar) a lo largo del tiempo. La secuencia que he hecho es la siguiente: attach(Libro1) plot (xbar~as.Date(fechas,"%d/%m/%y"), ylim=c(400,650), type="b", pch=19,cex=1)

Dear Dovecote devotees, I have been going through dovecot configuration for the first time. I am not an experienced systems administrator so I had to do a left turn to read up about PAM while doing all the configuration for my new webmail service. I found that the writing in the dovecot documentation about PAM to be rather misleading in at least one aspect. The documentation I am specifically

I've configured dovecot to authenticate against a Fedora Directory Server. The mail server on which dovecot is installed has the nss_ldap and pam_ldap packages installed, and /etc/dovecot.conf has the following two lines: auth_userdb = ldap /etc/dovecot-ldap.conf auth_passdb = pam In other words, I want dovecot to use LDAP to access the user database, but PAM for authentication. This part is

We are pleased to announce that John Chambers has joined the R core team. It is hard to believe that anyone on this list wouldn't know who John is, but just in case: He is the principal designer of the S language and environment, for which he received the ACM Software Systems Award in 1999. John has been very supportive and helpful throughout the development of R. He is joining the core

James Edward Gray II and myself will be leading the first meeting of the Oklahoma Ruby Users Group (OK.rb) on March 14th at 7 PM. The meeting will take place in room 104 in the Nigh University Center (student center) on the campus of the University of Central Oklahoma (UCO). The first meeting will cover both Ruby and Ruby on Rails and will be aimed at all skill levels. James will be giving a "Uniquely Ruby" talk, focusing on those things that make Ruby stand out from other languages. I will be giving a first-look at Rails presentation that will go a li...

We are pleased to announce that John Chambers has joined the R core team. It is hard to believe that anyone on this list wouldn't know who John is, but just in case: He is the principal designer of the S language and environment, for which he received the ACM Software Systems Award in 1999. John has been very supportive and helpful throughout the development of R. He is joining the core

...k you, Juan Antonio -- =========================================== J.A.Caballero M. Dpto. Estadistica e Investigacion Operativa Campus de Rabanales Edificio C-II Universidad de Cordoba 14080 SPAIN ------------------------------------------- tel +34 57 218480 fax +34 57 218123 e-mail ma1estad at uco.es =========================================== -.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.- r-help mailing list -- Read http://www.ci.tuwien.ac.at/~hornik/R/R-FAQ.html Send "info", "help", or "[un]subscribe" (in the "body&quot...

Robin Getz a ?crit : >> As I told you, bank is a reserved keyword in Analog Devices compiler for >> Blackfin architecture. > > This seems lame, and maybe you need to change the header files inside VDSP++. > (This is pretty common for VDSP users to do when name space clashes occur > with open source software). > > Poking at the VDSP docs, says that it uses bank()

...urrently i have the problem when trying to use a named based proxy for LMTP the process doesn't resolve the hostname and crashes: Feb 26 16:53:26 auth: Debug: ldap(vodafonemail56 at vodafone.de,::1): pass search: base=ou=mailboxes,ou=vfag,c=de,o=vodafone scope=subtree filter=(&(objectClass=uco)(mail=vodafonemail56 at vodafone.de)) fields=userpassword,isactive,host Feb 26 16:53:26 auth: Debug: ldap(vodafonemail56 at vodafone.de,::1): result: userpassword(password)=<hidden> proxy(proxy)=1 host(host)=kangaroo.arcor-so.net Feb 26 16:53:26 auth: Debug: master out: PASS 1 proxy...