Displaying 1 result from an estimated 1 matches for "tp1290289p1290289".
2010 Jan 26
4
reading a string vector
...eems to understand it as
a unique vector input when I read in like x <-
"atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I
can use each of the letters on my reading?
Thanks,
Beatriz
--
View this message in context: http://n4.nabble.com/reading-a-string-vector-tp1290289p1290289.html
Sent from the R help mailing list archive at Nabble.com.
[[alternative HTML version deleted]]