search for: tga

Displaying 20 results from an estimated 51 matches for "tga".

Did you mean: tag
2011 Nov 08
0
Sound shuts off when going past the main menu in MGS1
...452132 COM 23710 ADR 451F89 COM 19161 ADR 451FE3 COM 27021 ADR 45219B COM 8813 ADR 4521A7 COM 37470 ADR 4523C7 COM 57943 ADR 4523E7 COM 47470 ADR 45256B COM 60573 ADR 4525D6 Object Queue 0 Primitive Queue 0 RESIDENT TOP 8A8E20 LoadReq FS_LoadRequest: data.cnf 008A8E6C 1 HITEX_INIT: Id: 7591 Name: tga/br_s15.tga HITEX_INIT: Id: 59777 Name: tga/br_f00.tga HITEX_INIT: Id: 59778 Name: tga/br_f01.tga HITEX_INIT: Id: 59779 Name: tga/br_f02.tga HITEX_INIT: Id: 59780 Name: tga/br_f03.tga HITEX_INIT: Id: 7554 Name: tga/br_s00.tga HITEX_INIT: Id: 7555 Name: tga/br_s01.tga HITEX_INIT: Id: 7556 Name: tg...
2023 Jul 04
1
Found multiple results for "tga":
On 04/07/2023 17:14, Edson Wolf via samba wrote: > I only have a tga user. But it says it has multiple entries. > > ( ERROR: Failed to add members ['tga'] to group "backup" - Found > multiple results for "tga": ) > > root at dc0:~# samba-tool group list |grep backup > lpcfg_do_global_parameter: WARNING: The "doma...
2023 Jul 04
1
Found multiple results for "tga":
I only have a tga user. But it says it has multiple entries. ( ERROR: Failed to add members ['tga'] to group "backup" - Found multiple results for "tga": ) root at dc0:~# samba-tool group list |grep backup lpcfg_do_global_parameter: WARNING: The "domain logons" option is dep...
2008 Sep 03
0
[ANNOUNCE] xf86-video-tga 1.2.0
Adam Jackson (3): Uninclude xf86Version.h Fix distcheck tga 1.2.0 Brice Goglin (1): TGA_*_VERSION using PACKAGE_VERSION_* Dave Airlie (2): pciaccess conversion tga: fixup devPrivates James Cloos (2): Rename .cvsignore to .gitignore Add *~ to .gitignore to skip patch/emacs droppings git tag: xf86-video-tga-1.2.0 http://xorg...
2010 Jun 12
1
Problem launching Cursed mountain
...-------------------------------------------------------------------------------------- fixme:d3d9:Direct3DShaderValidatorCreate9 stub Starting logos 0: <pp>\logos\logo0.timg 1: <pp>\logos\logo1.timg 2: <pp>\logos\logo2.timg Create Font: <CP>\misc\fonts\<TP>\debug.tga Create Font: <CP>\misc\fonts\<TP>\normal.tga Create Font: <CP>\misc\fonts\<TP>\symbols.tga fixme:dsalsa:IDsDriverBufferImpl_SetVolumePan (0x5d35d08,0x5d36190): stub CreateCast Misc path = <CP>\Settings\misc.txt CreateCast Global path = <CP>\Settings\global.txt Cr...
2010 Oct 29
0
Wine release 1.3.6
The Wine development release 1.3.6 is now available. What's new in this release (see below for details): - Support for GStreamer filters. - Mapping of standard cursors to native desktop cursors. - Improved support for installers with services. - Many MSXML improvements. - Decoder for TGA-format images. - Translation updates. - Various bug fixes. The source is available from the following locations: http://ibiblio.org/pub/linux/system/emulators/wine/wine-1.3.6.tar.bz2 http://prdownloads.sourceforge.net/wine/wine-1.3.6.tar.bz2 Binary packages for various distributions will...
2008 Dec 17
2
Something strange! Wine 1.10 doesn't want to delete stuff.
So, recentley I upgraded to the new 1.10 with apt, I am running 2.6.24-21-generic #1 SMP kernel, although I don't know why it thinks I have to have smp, I have a 2400+ sempron, my v-card is a 7300Gt nvidia. And after I upgraded, I shut it down and I went to bed. The next day, I tried to play WoW, everything was cool, no glitches, it ran noticeably faster, so I changed the graphics settings
2001 Jan 10
3
Video compression, edge detection, and gcc warnings
<WARNING: Long message ahead> Well, I have actually done something the past 1 1/2 week. I've created a program that runs several filters over an image to extract edge information. Currently it loads any uncompressed grayscale TGA file, and spits out another uncompressed greyscale TGA file that is 255 at places where there are edges, and 0 where there are not. I managed to get out quite a lot of noise. You can find a test image and the result at http://home.student.utwente.nl/l.e.veen/test4.jpg and http://home.student.utwen...
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... > uco(newdata5,index="rscu") aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag cat NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA...
1999 Jun 17
0
Forw: [RHSA-1999:013-01] New XFree86 packages for Red Hat Linux 6.0
...2.alpha.rpm XFree86-75dpi-fonts-3.3.3.1-52.alpha.rpm XFree86-FBDev-3.3.3.1-52.alpha.rpm XFree86-Mach64-3.3.3.1-52.alpha.rpm XFree86-Mono-3.3.3.1-52.alpha.rpm XFree86-P9000-3.3.3.1-52.alpha.rpm XFree86-S3-3.3.3.1-52.alpha.rpm XFree86-S3V-3.3.3.1-52.alpha.rpm XFree86-SVGA-3.3.3.1-52.alpha.rpm XFree86-TGA-3.3.3.1-52.alpha.rpm XFree86-Xnest-3.3.3.1-52.alpha.rpm XFree86-Xvfb-3.3.3.1-52.alpha.rpm XFree86-cyrillic-fonts-3.3.3.1-52.alpha.rpm XFree86-devel-3.3.3.1-52.alpha.rpm XFree86-doc-3.3.3.1-52.alpha.rpm XFree86-libs-3.3.3.1-52.alpha.rpm XFree86-xfs-3.3.3.1-52.alpha.rpm Sparc: ftp://updates.redhat.c...
2008 Apr 07
2
problem with Rmpi 0.5-5 and openmpi
...taz=00;31:*.lzh=00;31:*.zip=00 ;31:*.zoo=00;31:*.z=00;31:*.Z=00;31:*.gz=00;31:*.bz2=00;31:*.tb2=00;31:*.tz2=00;31:*.tbz2=00;31 :*.avi=01;35:*.bmp=01;35:*.fli=01;35:*.gif=01;35:*.jpg=01;35:*.jpeg=01;35:*.mng=01;35:*.mov=01; 35:*.mpg=01;35:*.pcx=01;35:*.pbm=01;35:*.pgm=01;35:*.png=01;35:*.ppm=01;35:*.tga=01;35:*.tif=01 ;35:*.xbm=01;35:*.xpm=01;35:*.dl=01;35:*.gl=01;35:*.aiff=00;32:*.au=00;32:*.mid=00;32:*.mp3=00; 32:*.ogg=00;32:*.voc=00;32:*.wav=00;32: LD_LIBRARY_PATH=/opt/openmpi/lib:/opt/sge/lib/lx24-amd64 XNLSPATH=/usr/X11R6/lib/X11/nls HOSTTYPE=x86_64 PAGER=less XDG_CONFIG_DIRS=/usr/local/etc/x...
1999 Jun 17
0
Forw: [RHSA-1999:013-02] New XFree86 packages (updated)
...2.alpha.rpm XFree86-75dpi-fonts-3.3.3.1-52.alpha.rpm XFree86-FBDev-3.3.3.1-52.alpha.rpm XFree86-Mach64-3.3.3.1-52.alpha.rpm XFree86-Mono-3.3.3.1-52.alpha.rpm XFree86-P9000-3.3.3.1-52.alpha.rpm XFree86-S3-3.3.3.1-52.alpha.rpm XFree86-S3V-3.3.3.1-52.alpha.rpm XFree86-SVGA-3.3.3.1-52.alpha.rpm XFree86-TGA-3.3.3.1-52.alpha.rpm XFree86-Xnest-3.3.3.1-52.alpha.rpm XFree86-Xvfb-3.3.3.1-52.alpha.rpm XFree86-cyrillic-fonts-3.3.3.1-52.alpha.rpm XFree86-devel-3.3.3.1-52.alpha.rpm XFree86-doc-3.3.3.1-52.alpha.rpm XFree86-libs-3.3.3.1-52.alpha.rpm XFree86-xfs-3.3.3.1-52.alpha.rpm Sparc: ftp://updates.redhat.c...
2015 Sep 04
0
Login "error" message
...38;5;9:*.xz=38;5;9:*.bz2=38;5;9:*.tbz=38;5;9:*.tbz2=38;5;9:*.bz=38;5;9:*.tz=38;5;9:*.deb=38;5;9:*.rpm=38;5;9:*.jar=38;5;9:*.rar=38;5;9:*.ace=38;5;9:*.zoo=38;5;9:*.cpio=38;5;9:*.7z=38;5;9:*.rz=38;5;9:*.jpg=38;5;13:*.jpeg=38;5;13:*.gif=38;5;13:*.bmp=38;5;13:*.pbm=38;5;13:*.pgm=38;5;13:*.ppm=38;5;13:*.tga=38;5;13:*.xbm=38;5;13:*.xpm=38;5;13:*.tif=38;5;13:*.tiff=38;5;13:*.png=38;5;13:*.svg=38;5;13:*.svgz=38;5;13:*.mng=38;5;13:*.pcx=38;5;13:*.mov=38;5;13:*.mpg=38;5;13:*.mpeg=38;5;13:*.m2v=38;5;13:*.mkv=38;5;13:*.ogm=38;5;13:*.mp4=38;5;13:*.m4v=38;5;13:*.mp4v=38;5;13:*.vob=38;5;13:*.qt=38;5;13:*.nuv=38...
2002 May 21
1
Graphical Splash Screen
Hi, Do you have instructions on how to create my own Graphical Splash Screen for use with SysLinux? -- Peace and Long Life, Matt
2006 Feb 15
0
setup program doesn't find extracted dll
...o=01;35:do=01;35:bd=40;33;01:cd=40;33;01:or=40;31;01:ex=01;32:*.tar=01;31:*.tgz=01;31:*.arj=01;31:*.taz=01;31:*.lzh=01;31:*.zip=01;31:*.z=01;31:*.Z=01;31:*.gz=01;31:*.bz2=01;31:*.deb=01;31:*.rpm=01;31:*.jar=01;31:*.jpg=01;35:*.jpeg=01;35:*.gif=01;35:*.bmp=01;35:*.pbm=01;35:*.pgm=01;35:*.ppm=01;35:*.tga=01;35:*.xbm=01;35:*.xpm=01;35:*.tif=01;35:*.tiff=01;35:*.png=01;35:*.mov=01;35:*.mpg=01;35:*.mpeg=01;35:*.avi=01;35:*.fli=01;35:*.gl=01;35:*.dl=01;35:*.xcf=01;35:*.xwd=01;35:*.ogg=01;35:*.mp3=01;35:*.wav=01;35: GNOME_KEYRING_SOCKET=/tmp/keyring-Z6Fv5o/socket SSH_AUTH_SOCK=/tmp/ssh-dMkFpL7632/agent....
2011 Jul 19
1
Re: Problem with Windows app accessing internet
...31:*.dz=01;31:*.gz=01;31:*.lz=01;31:*.xz=01;31:*.bz2=01;31:*.bz=01;31:*.tbz=01;31:*.tbz2=01;31:*.tz=01;31:*.deb=01;31:*.rpm=01;31:*.jar=01;31:*.rar=01;31:*.ace=01;31:*.zoo=01;31:*.cpio=01;31:*.7z=01;31:*.rz=01;31:*.jpg=01;35:*.jpeg=01;35:*.gif=01;35:*.bmp=01;35:*.pbm=01;35:*.pgm=01;35:*.ppm=01;35:*.tga=01;35:*.xbm=01;35:*.xpm=01;35:*.tif=01;35:*.tiff=01;35:*.png=01;35:*.svg=01;35:*.svgz=01;35:*.mng=01;35:*.pcx=01;35:*.mov=01;35:*.mpg=01;35:*.mpeg=01;35:*.m2v=01;35:*.mkv=01;35:*.ogm=01;35:*.mp4=01;35:*.m4v=01;35:*.mp4v=01;35:*.vob=01;35:*.qt=01;35:*.nuv=01;35:*.wmv=01;35:*.asf=01;35:*.rm=01;35:*.r...
2012 Oct 29
3
[Bug 56546] New: crash at the second render when applying gamma correction
...hment 69256 --> https://bugs.freedesktop.org/attachment.cgi?id=69256&action=edit example of the crash Here a very simple program which illustrate a bug in driver 2.1 Mesa 8.0.4 when applying a gamma value with opengl. (The program is OK with driver NVIDIA). In attachment, the file utc24.tga used by the program glut_gamma_bug.cpp. Compile the program with the command: g++ -L/usr/lib64 -lGL -lGLU -lglut -lX11 -lXi -lxcb-glx -lxcb-xlib -ldl glut_gamma_bug.cpp Start it with: ./a.out It will open a small window with an image composed of vertical strips. Press the enter key (it apply a...
2008 Mar 02
1
Wrong uptodate
...o=01;35:do=01;35:bd=40;33;01:cd=40;33;01:or=40;31;01:ex=01;32:*.tar=01;31:*.tgz=01;31:*.arj=01;31:*.taz=01;31:*.lzh=01;31:*.zip=01;31:*.z=01;31:*.Z=01;31:*.gz=01;31:*.bz2=01;31:*.deb=01;31:*.rpm=01;31:*.jar=01;31:*.jpg=01;35:*.jpeg=01;35:*.gif=01;35:*.bmp=01;35:*.pbm=01;35:*.pgm=01;35:*.ppm=01;35:*.tga=01;35:*.xbm=01;35:*.xpm=01;35:*.tif=01;35:*.tiff=01;35:*.png=01;35:*.mov=01;35:*.mpg=01;35:*.mpeg=01;35:*.avi=01;35:*.fli=01;35:*.gl=01;35:*.dl=01;35:*.xcf=01;35:*.xwd=01;35:*.ogg=01;35:*.mp3=01;35:*.wav=01;35:' LS_OPTIONS=--color=auto MACHTYPE=i386-pc-linux-gnu MAIL=/var/mail/root MAILCHECK=60...
2015 Aug 14
2
Build R on Haiku
....bz=01;31:*.tbz=01;31:*.tbz2=01;31:*.tz=01;31:*.deb=01;31:*.rpm=01;31:*.jar=01;31:*.war=01;31:*.ear=01;31:*.sar=01;31:*.rar=01;31:*.alz=01;31:*.ace=01;31:*.zoo=01;31:*.cpio=01;31:*.7z=01;31:*.rz=01;31:*.cab=01;31:*.jpg=01;35:*.jpeg=01;35:*.gif=01;35:*.bmp=01;35:*.pbm=01;35:*.pgm=01;35:*.ppm=01;35:*.tga=01;35:*.xbm=01;35:*.xpm=01;35:*.tif=01;35:*.tiff=01;35:*.png=01;35:*.svg=01;35:*.svgz=01;35:*.mng=01;35:*.pcx=01;35:*.mov=01;35:*.mpg=01;35:*.mpeg=01;35:*.m2v=01;35:*.mkv=01;35:*.webm=01;35:*.ogm=01;35:*.mp4=01;35:*.m4v=01;35:*.mp4v=01;35:*.vob=01;35:*.qt=01;35:*.nuv=01;35:*.wmv=01;35:*.asf=01;35:*...
2015 Oct 19
1
R 3.2.2 - make check and install package hang
...31:*.dz=01;31:*.gz=01;31:*.lz=01;31:*.xz=01;31:*.bz2=01;31:*.tbz=01;31:*.tbz2=01;31:*.bz=01;31:*.tz=01;31:*.deb=01;31:*.rpm=01;31:*.jar=01;31:*.rar=01;31:*.ace=01;31:*.zoo=01;31:*.cpio=01;31:*.7z=01;31:*.rz=01;31:*.jpg=01;35:*.jpeg=01;35:*.gif=01;35:*.bmp=01;35:*.pbm=01;35:*.pgm=01;35:*.ppm=01;35:*.tga=01;35:*.xbm=01;35:*.xpm=01;35:*.tif=01;35:*.tiff=01;35:*.png=01;35:*.svg=01;35:*.svgz=01;35:*.mng=01;35:*.pcx=01;35:*.mov=01;35:*.mpg=01;35:*.mpeg=01;35:*.m2v=01;35:*.mkv=01;35:*.ogm=01;35:*.mp4=01;35:*.m4v=01;35:*.mp4v=01;35:*.vob=01;35:*.qt=01;35:*.nuv=01;35:*.wmv=01;35:*.asf=01;35:*.rm=01;35:*.r...