search for: tats

> resp <- postForm('http://our.db/db/new', 'profileid'='181133', 'value'='20110225', 'type'='history','user-agent' = 'R', .opts =list(verbose=T, userpwd='test:test')) * About to connect() to our.db port 80 (#0) * Trying 192.168.1.1... * connected * Connected to our.db (192.168.1.1) port 80 (#0) > POST

Dear all,   i would like to count the number of times where I have combined occurrences of the categories of 2 variables.   For instance, in the dataframe below, i would like to know how many times each author (au1, au2, au3 represent the first, second, third author) is associated with each of the category of the variable 'nam'. The position of the author does not matter.   nam <-

Dear R-users, I am trying to produce trellis (png, or jpeg) graphs with transparent background, but I cannot manage to make that happen. I tried to play around with themes but to no avail. Any advise on the following example will be greatly appreciated: Thank you Sebastien #### library(lattice) df <- data.frame(a=rep(1:4,4), b=rep(1:4,4), c=rep(1:4,each=4)) settings <- standard.theme()

On Wed, Nov 02, 2016 at 07:15:17PM +0200, Timo Sirainen wrote: > On 01 Nov 2016, at 18:26, The Doctor <doctor at doctor.nl2k.ab.ca> wrote: > > > > Getting complaints from people about pop/imap > > > > issues. > > > > some people are getting repaeted e-mail. > > > > Other are not able to delete their e-mails from an IMAP lcient. >

Hi Jeremy, An easy way to start troubleshooting these is to look at the audit logs and > see what SELInux is blocking. You have /McFrazier in the email.. if that's > off the root tree than unless you've set permissions to allow httpd to look > at tat folder, I bet that's one problem. > if you run ls -Z you can see the labels that are present on those folders, > that

Hello To update from R 2.6 to 2.8 (on Ubuntu 8.04 both) I had to install new tcl and liblapack packages (excuse me it is in french): > sudo apt-get install r-base-dev > Lecture des listes de paquets... Fait > Construction de l'arbre des d?pendances > Lecture des informations d'?tat... Fait > Les paquets suppl?mentaires suivants seront install?s : >

Dear all, I am working on an author network and to do so I have to arrange a data.frame (tutu) crossing author names (rows) per publication number (column). The participation of the author to a study is indicated by a 1 and 0 otherwise. I have a vector (xaulist) of all the names of authors and a data.frame (tata) with all the publications in row and the authors in columns. I have writen a loop

Hi List, I run XEN 2 since some month (unfortunatly installed by a fiend of mine). Recently I bought some new hardware and tried to get XEN 3 running on a Debian Sarge 3.1. I installed via the Debian installer a RAID 1 with LVM. even though there are some devfs_mk_dir errors systems comes up. Now I installed XEN but system doe not boot as the boot device seems not to be recocnized by the

Hey all, There's a website I help run that uses the Cassandra DB as its database. I notice that if I run the web server in SELinux permissive mode, the site works fine. But if I put it into enforcing mode, the site goes down with this error: Warning: require_once(/McFrazier/PhpBinaryCql/CqlClient.php): failed to open stream: Permission denied in

i`ve found a bug in chain.c32 in v4.06. When i use isolinux it does not run windows7 installation, chainloading bootmgr. the error is: Can't find myself on the drive I booted from. chain.c32 from syslinux 3.xx works like a charm! chain.c32 from syslinux 5 shous tat this is not a com32 app

Hello all, I?ve found another issue with the queue application. Assuming I?ve configured a queue with a long periodic announcement and have two queue members assigned. Both queue members are busy at a time, while another caller is joining the queue. After a while the periodic announcement is played back to the caller, in that case it takes about 40 seconds to be played back. If then one of the

I have got it. It works now. The problem actually lies with the passwd chat line. This applies to Mandrake Distro. [global] .. preferred master = yes logon script = netlogon.bat passwd chat = *New*UNIX*password* %n\n *Retype*new*UNIX*password* %n *passwd:all*authentication*tokens*updated*successfully* security = user ... Just wanted to share with you ppl. Cheers

Hi everyone, i have 20 fields in users table. in my admin profile module the admin can modify his infomation. but only 12 fields he can able to modify. so in my controller if params[ :profileinfo ][:first_name] @profileinfo.update_attribute(:first_name,params[ :profileinfo ][:first_name]) end the above simply saves what i enter into the field.why it doesnot consider the modelvalidation.

http://bugs.freedesktop.org/show_bug.cgi?id=25634 Summary: [swfdec 0.9.2] Segmentation Fault, assertion 'SWFDEC_IS_AUDIO' failed Product: swfdec Version: unspecified Platform: x86-64 (AMD64) OS/Version: BSD (Others) Status: NEW Severity: normal Priority: medium Component:

Hi, using both OpenSSH_2.5.1p1 (compiled myself) and openssh-2.9p1-23.i386.rpm from ftp.suse.com 7.2_update I get the following "leak" : using `scp' I tried to copy a file from a local floppy disk to a remote system, but the disk had an read error and scp didn't get any real data from floppy: turtle koenig > scp /media/floppy/file.c harald:file.c

Hi there, I think I have found a small problem in the "/my/path/R-2.0.1/src/modules/X11/MakeFile" generation. During the configure step, I have specified a specific JPEG library by exporting CPPFLAGS variable. All compilation works well for individual files in the src/modules/X11/ directory, but when linking, the -ljpeg option doesn't work. I obtain the following message (in french

Hi Samba People ! I'm experiencing some issues with the smbldap-tools suite and post it here in hope someone could give me some help. I want first to thank you if you take teh time to read my message til the end, as it's a little bit long ;) We do have a Debian Box on our LAN we use primarily as a File Server. This server has initially been setup with Etch (4.0, net-install). I've

Hi all, I have a problem when I try to compil samba 4.0.6 on my test machine (suse linux enterprise server 11 SP2 32-bits). output of compilation : [3353/3781] Linking default/lib/param/libsamba-hostconfig.so [3354/3781] Linking default/lib/tdb_wrap/libtdb-wrap.so [3355/3781] Linking default/libcli/security/libsamba-security.so [3356/3781] Linking default/lib/util/libutil_tdb.so

Hi, Xorcom astribanks get initialized straight on when using Ubuntu 11.10 packages but I am having a hard time to get the same result running in a qemu/libvirt image. The first difficulty is that astribanks devices get different usb device ids during their initialisation process, requiring hot plug support. I have figured out how to solve this issue using the technique described in this post :

Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... >