search for: slengths

Displaying 2 results from an estimated 2 matches for "slengths".

Did you mean: lengths
2009 Jun 01
1
t.tests by unique groupes
My data (slength) look like this: Plant Block Treat Genotype Source MPH 1 1 1 w 05-AZM sp 160 NA 2 2 1 w 12-50 463 NA 3 3 1 w 12-51 sp 150 0.0508982 4 5 1 w 29-42 567 0.9017094 5 6 1 w KNG-KNG 811 NA 6 7 1 w 02-02 1 NA Treat column
2007 Sep 05
6
length of a string
Dear all, I would like to know how can I compute the length of a string in a dataframe. Example: SEQUENCE ID TGCTCCCATCTCCACGG HR04FS000000645 ACTGAACTCCCATCTCCAAT HR00000595847847 I would like to know how to compute the length of each SEQUENCE. Best regards, João Fadista [[alternative HTML version deleted]]