Displaying 3 results from an estimated 3 matches for "rscu".
Did you mean:
rcu
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
> uco(newdata5,index="rscu")
aaa aac...
2006 Jul 25
0
seqinr updated : release 1.0-5
...this at the nucleic acid level from a clustalw output. This can be done
on the fly if clustalw is available on your platform.
http://pbil.univ-lyon1.fr/software/SeqinR/SEQINR_CRAN/DOC/html/reverse.align.html
o An undocumented behavior was reported by Guy Perriere for uco() when
computing RSCU on sequences where an amino-acid is missing. There is
now a new argument NA.rscu that allows the user to force the missing
values to his favorite magic value.
http://pbil.univ-lyon1.fr/software/SeqinR/SEQINR_CRAN/DOC/html/uco.html
o There was a bug in read.fasta(): some sequence names we...
2006 Jul 25
0
seqinr updated : release 1.0-5
...this at the nucleic acid level from a clustalw output. This can be done
on the fly if clustalw is available on your platform.
http://pbil.univ-lyon1.fr/software/SeqinR/SEQINR_CRAN/DOC/html/reverse.align.html
o An undocumented behavior was reported by Guy Perriere for uco() when
computing RSCU on sequences where an amino-acid is missing. There is
now a new argument NA.rscu that allows the user to force the missing
values to his favorite magic value.
http://pbil.univ-lyon1.fr/software/SeqinR/SEQINR_CRAN/DOC/html/uco.html
o There was a bug in read.fasta(): some sequence names we...