search for: pmsequence

Displaying 1 result from an estimated 1 matches for "pmsequence".

Did you mean: asequence
2012 Oct 07
1
BioConductor package: 'oligo'
Dear Help, After loading the pd.Citrus library and checking the DataFrame, I ran > the R code for: > > 1) 'oligo' > > > > {> library(pd.citrus) > Loading required package: RSQLite > Loading required package: DBI > > data(pmSequence) > > > show(pmSequence) > DataFrame with 341730 rows and 2 columns > fid sequence > <integer> <DNAStringSet> > 1 990 GCTTTTGGAACGATGGCGATGGCTA > 2 991 CGACGGGTTGCCTTCGGAGCTAAAT > 3 992 TACTGCAGAAGACCATTACCCTACA > 4 993 TCACATAGCTGTGCAAGGACCGTAT > 5 994 T...