search for: or1

Hello, I'm sorry if this seems similar to my last post but I thought it was significantly different to warrent a new thread. Using the dataset below, is there a way to generate a bar/line plot for the TACC/Catch of every lvl of stock? i.e. OR1,OR3,OR5. The picture at the bottom of this post is an example of the bar/line plot for OR1 which was generated when OR1 was the only stock in the table. This was created, with help from Marc Schwartz, using: > mp <- barplot(fish$TACC, space = 0, names.arg = fish$Year,ylim=c(0,13000)) &gt...

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or...

...d 2005 catch>TACC) R seems to cut them off, I need the axis to be expanded so they can be seen. I'm sure these are relatively simple problems but I am really stuck. Thanks very much for all your help, it is much appreciated. James DATA: Year Species Stock TACC Catch 1 2001 ORH OR1 5000 4687 2 2002 ORH OR1 6000 3215 3 2003 ORH OR1 7000 6782 4 2004 ORH OR1 9000 10000 5 2005 ORH OR1 9000 12000 -- View this message in context: http://www.nabble.com/Bar-Plot-with-Connected-Points-on-1-Y-Axis-tp21324029p21324029.html Sent from the R help mai...

Buenas noches Javier y José, Estoy en contra de usar attach(), asi que propongo la siguiente alternativa con with(): # paquete require(epicalc) # los argumentos en ... pasan de epicalc:::cc # ver ?cc para mas informacion foo <- function(var1, var2, var3, ...){ or1 <- cc(var1, var2, ...) or2 <- cc(var1, var3, ...) list(or1 = or1, or2 = or2) } # datos x <- read.csv("~/Downloads/OR.csv") head(x) # resultados SIN graficas with(x, foo(estado, cake, chocolate, graph = FALSE)) Saludos, Jorge.- 2014-08-21 12:40 GMT+10:00 Javier Marcuzzi &lt...

Hi all, The machine I am targeting has some special requirements for some operations, say: ADD or1, ir1, r5 would add ir1 (input reg 1) and r5 and put the result in or1 (output reg 1). The point id that input and output regs have to go paired (this meaning an addition of ir1 with whatever always goes to or1, or an in general irX + whatever goes to orX). AFAIK, InstrInfo.td only allow "$sr...

...d.csv("OR.csv",header=TRUE, sep=",", dec=".") use(data) attach(data) var1=estado var2=cake var3=chocolate library(epicalc) source("function_or.r") odratios(data,var1,var2,var3) #función odratios <- function (data,var1,var2,var3){ or1 <-cc(var1, var2) or2 <- cc(var1, var3) } -- Nunca digas nunca, di mejor: gracias, permiso, disculpe. Este mensaje le ha llegado mediante el servicio de correo electronico que ofrece Infomed para respaldar el cumplimiento de las misiones del Sistema Nacional de Salud. La persona...

On Sep 7, 2010, at 3:01 AM, Carlos Sanchez de La Lama wrote: > The machine I am targeting has some special requirements for some > operations, say: > > ADD or1, ir1, r5 > > would add ir1 (input reg 1) and r5 and put the result in or1 (output reg > 1). The point id that input and output regs have to go paired (this > meaning an addition of ir1 with whatever always goes to or1, or an in > general irX + whatever goes to orX). > > AFAIK...

# is there a bug in the calculation of the odds ratio in fisher.test? # Nicholas Horton, nhorton at smith.edu Fri Jan 22 08:29:07 EST 2010 x1 = c(rep(0, 244), rep(1, 209)) x2 = c(rep(0, 177), rep(1, 67), rep(0, 169), rep(1, 40)) or1 = sum(x1==1&x2==1)*sum(x1==0&x2==0)/ (sum(x1==1&x2==0)*sum(x1==0&x2==1)) library(epitools) or2 = oddsratio.wald(x1, x2)$measure[2,1] or3 = fisher.test(x1, x2)$estimate # or1=or2 = 0.625276, but or3=0.6259267! I'm running R 2.10.1 under Mac OS X 10.6.2. Nick Nicholas...

...reate a <3 x i32> vector in LLVM IR. Then I insert 3 instructions and later on I try to load one instruction from the vector. The insertion seems to work, however, when I try to load a specific instruction from a vector I seems that it does not work. This is the part of my IR: %"ins or1" = insertelement <3 x i32> undef, i32 %38, i32 0 %"ins and2" = insertelement <3 x i32> undef, i32 %41, i32 1 %"ins xor3" = insertelement <3 x i32> undef, i32 %43, i32 2 %extract4 = extractelement <3 x i32> undef, i32 %35 ... store i32 %extract4, i32*...

The following piece of code triggers an 'unimplemented' exception with the message: "Can't use NEAR/PHRASE with a subexpression containing NEAR or PHRASE" Xapian::Query or1(Xapian::Query::OP_OR, Xapian::Query("one"), Xapian::Query("two")); Xapian::Query or2(Xapian::Query::OP_OR, Xapian::Query("three"), Xapian::Query("four")); Xapian::Query near(Xapian::Query::OP_NEAR, or1, or2); I can'...

...and i32 %x, 16711680 ; 0x00ff0000 > > %byte3 = and i32 %x, 4278190080 ; 0xff000000 > > %tmp0 = shl i32 %byte0, 8 > > %tmp1 = lshr i32 %byte1, 8 > > %tmp2 = shl i32 %byte2, 8 > > %tmp3 = lshr i32 %byte3, 8 > > %or0 = or i32 %tmp0, %tmp1 > > %or1 = or i32 %tmp2, %tmp3 > > %result = or i32 %or0, %or1 > > ret i32 %result > > } > > I’m still investigating exactly how it’s failing on this one; let me > know if I’m missing something else here. > > Oh, I see... yes, the existing tree matching logic is comple...

...rix to the PBQP instance: [ 0 inf inf inf ] [ inf 0 inf inf ] [ inf inf 0 inf ] [ inf inf inf 0 ] The rows and columns of this matrix reflect the storage locations that the allocator can assign, and the elements represent the cost of a specific assignment. Say the rows represent the set { or1, or2, or3, or4 } and the columns represent { ir1, ir2, ir3, ir4 }. The infinite cost elements constrain the valid assignments to matching pairs. Representing the constraint is dead easy, the trick would be making the allocator aware of the constraint. At present the PBQP allocator only "know...

Hi Gordan, I received my Asus GTX 480 today (bought on ebay). Finally I succeeded in - quadrifying my GTX 480  into a Quadro 6000 ( softmod). - overpassing the 3-4GB of RAM on Windows XP 64 bits (domU) by applying a well known patch for Xen. - playing Crysis 2 and Darksiders II for a few minutes. http://img11.hostingpics.net/pics/953254ScreenshotXenSoftModedQuadro6000.png Using nvlfash I

...stimates of OR and their confidence limits, like a scatter plot: the vertical axis should be the estimated OR (with upper and lower conf. limits), and the horizontal exis should be fixed values: (1,0.8,0.7,0.6,0.5,0.4) Here is a part of my code: ...ests=matrix(ncol=3,nrow=6) ests[,1]<-c(mean(or1),mean(or14),mean(or15),mean(or16),mean(or17),mean(or18)) ests[,2]<-c(cl1,cl14,cl15,cl16,cl17,cl18) ests[,3]<-c(cu1,cu14,cu15,cu16,cu17,cu18) x1<-c(1,0.8,0.7,0.6,0.5,0.4)... Now I have a matrix with three columns: estimate, lower limit of the confidende interval, and upper limit of the...

>> Are you sure there isn't any test coverage? As far as I can tell, the tests from https://reviews.llvm.org/rL133503 are still in the tree. I looked at those, but none of them include the full pattern that decomposes into bswap and rol. I debugged through the X86 bswap.ll test and verified none of those cases make it through MatchBSwapHWord (they get handled in MatchBSwapHWordLow

...;> some >>>> of those >>>> are blocked. Ie. Here again it says that ovirt8z2 is >>>> having active >>>> lock even ovirt8z2 crashed after the lock was >>>> granted.: >>>> >>>> [xlator.features.locks.zone2-ssd1-vmstor1-locks.inode] >>>> path=/.shard/3d55f8cc-cda9-489a-b0a3-fd0f43d67876.27 >>>> mandatory=0 >>>> inodelk-count=3 >>>> >>>> lock-dump.domain.domain=zone2-ssd1-vmstor1-replicate-0:self-heal >>>> inodelk.inodelk[0](ACTIVE)=type=WRITE,...

On 29 Jan 2018 10:50 am, "Samuli Heinonen" <samppah at neutraali.net> wrote: Hi! Yes, thank you for asking. I found out this line in the production environment: lgetxattr("/tmp/zone2-ssd1-vmstor1.s6jvPu//.shard/f349ffbd- a423-4fb2-b83c-2d1d5e78e1fb.32", "glusterfs.clrlk.tinode.kblocked", 0x7f2d7c4379f0, 4096) = -1 EPERM (Operation not permitted) I was expecting .kall instead of .blocked, did you change the cli to kind blocked? And this one in test environment (with posix...

...files and some >> of those >> are blocked. Ie. Here again it says that ovirt8z2 is >> having active >> lock even ovirt8z2 crashed after the lock was granted.: >> >> [xlator.features.locks.zone2-ssd1-vmstor1-locks.inode] >> path=/.shard/3d55f8cc-cda9-489a-b0a3-fd0f43d67876.27 >> mandatory=0 >> inodelk-count=3 >> lock-dump.domain.domain=zone2-ssd1-vmstor1-replicate-0:self- >> heal >> inodelk.inodelk[0](ACTIVE...

...locks on files and >>> some >>> of those >>> are blocked. Ie. Here again it says that ovirt8z2 is >>> having active >>> lock even ovirt8z2 crashed after the lock was >>> granted.: >>> >>> [xlator.features.locks.zone2-ssd1-vmstor1-locks.inode] >>> path=/.shard/3d55f8cc-cda9-489a-b0a3-fd0f43d67876.27 >>> mandatory=0 >>> inodelk-count=3 >>> >>> lock-dump.domain.domain=zone2-ssd1-vmstor1-replicate-0:self-heal >>> inodelk.inodelk[0](ACTIVE)=type=WRITE, whence=0, >>>...

...gt; of those >>>>> are blocked. Ie. Here again it says that ovirt8z2 is >>>>> having active >>>>> lock even ovirt8z2 crashed after the lock was >>>>> granted.: >>>>> >>>>> [xlator.features.locks.zone2-ssd1-vmstor1-locks.inode] >>>>> path=/.shard/3d55f8cc-cda9-489a-b0a3-fd0f43d67876.27 >>>>> mandatory=0 >>>>> inodelk-count=3 >>>>> >>>>> lock-dump.domain.domain=zone2-ssd1-vmstor1-replicate-0:self-heal >>>>> inodelk.inodel...