search for: lines2

...12????? 14.10 1911.06.13?????? 7.87 1911.06.14?????? 9.26 1911.07.15?????? 8.06 1911.07.16?????? 8.13 1911.08.17????? 12.90 1911.08.18?????? 5.45 1911.09.19?????? 3.26 1911.09.20?????? 5.70 1911.10.21?????? 9.24 1911.10.22?????? 7.60 1911.11.23????? 14.82 1911.12.24????? 14.10"))? Lines2<-Lines1[Lines1!=""] library(stringr) ?str_count(Lines2, " ") # [1] 7 7 7 7 6 7 7 7 7 7 6 6 7 7 7 7 6 7 7 7 7 7 6 6 Lines2[str_count(Lines2," ")==7]<- str_replace(Lines2[str_count(Lines2," ")==7],"\\s+","???? ") #reduced 2 spaces ?...

Hi, Try this: lines1<- readLines(textConnection("gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789")) lines2<-readLines(textConnection(">or1|1234 ATCGGATTCAGG >or2|347 GAACCTATCGGGGGGGGAATTTATATATTTTA >or3|56 ATCGGAGATATAACCAATC >or3|23 AAAATTAACAAGAGAATAGACAAAAAAA >or4|793 ATCTCTCTCCTCTCTCTCTAAAAA >or7|123456789 ACGTGTGTACCCCC"))? lines2New<-unlist(lapply(split(lines2,(...

...????? 1 #or res11<-do.call(rbind,lapply(res1,function(x) tail(x,-1))) row.names(res11)<-1:nrow(res11) A.K. ________________________________ From: GUANGUAN LUO <guanguanluo at gmail.com> To: arun <smartpink111 at yahoo.com> Sent: Tuesday, June 4, 2013 2:10 PM Subject: choose the lines2 13 2 12 2011/7/5 12 -1 0 14 2 13 2011/8/7 13 0.9 0 15 2 14 2011/9/11 14 -0.8 1 52 5 8 2011/1/11 7 -2.8 0 53 5 9 2011/2/13 8 0 0 54 5 10 2011/3/19 9 -1.2 1 74 6 9 2011/2/5 8 0.8 0 75 6 10 2011/3/9 9 0.15 0 76 6 11 2011/4/11 10 -0.45 1 those are the result which i want, and then i want t...

Hi R users, Wonder if somebody could give me help on how to reshape this type of data: ----------------------------------------------------------------------------------------------------------------------- Date:10.09.19 Time:21:39:05 Lat:N62.37.18 Long:E018.07.32 0000-0010 | 28| 28 0010-0020| 302| 302 0020-0030| 42| 42 0030-0040| 2| 2 0040-0050| 1| 1 0060-0070| 1| 1

...related to the following from the NEWS file: o Connections will be closed if there is no R object referring to them. A warning is issued if this is done, either at garbage collection or if all the connection slots are in use. If we use read.table directly it still happens: # use Lines and Lines2 from cited post library(zoo) DF1 <- read.table(textConnection(Lines), header = TRUE) DF2 <- read.table(textConnection(Lines2), header = TRUE) z1 <- zoo(as.matrix(DF1[-1]), as.Date(DF1[,1], "%d/%m/%Y")) z2 <- zoo(as.matrix(DF2[-1]), as.Date(DF2[,1], "%d/%m/%Y")) both...

...????? 0 #54 54????????? 5???? 10?? 2011-03-19 9???? -1.2??????????? 1 # #[[2]] ?# [,1] #2? 0.9 #5? 0.0 A.K. ________________________________ From: GUANGUAN LUO <guanguanluo at gmail.com> To: arun <smartpink111 at yahoo.com> Sent: Tuesday, June 4, 2013 3:54 AM Subject: choose the lines2 Hello, Arun,? now it is nearly the same problem. I want to know if I want to choose three period : one line with evnmt_brutal ==0 , one line with evnmt_brutal==0 and one line with evnmt_brutal==1, then I want to choose the second and third period for each patient, so that i can calculate the ave...

Hi all; I have a data set with the format below: Year, Day, Hour, Value 2010, 001, 0, 15.9 2010, 001, 1, 7.3 2010, 001, 2, 5.2 2010, 001, 3, 8.0 2010, 001, 4, 0.0 2010, 001, 5, 12.1 2010, 001, 6, 11.6 2010, 001, 7, 13.9 2010, 001, 8, 11.9 2010, 001, 9, 13.6 2010, 001, 10, 16.1 2010, 001, 11, 18.5 That should

...PROTECT(lines = allocVector(INTSXP, size)); + tab = INTEGER(lines); + for (i = 0; i < size; ++i) + tab[i] = 0; + UNPROTECT(1); + return lines; +} + +/* store a new line occurrence in R_Cov_freqs_hash for filename */ +static void cov_store_new_line(const char* filename, int line) { + SEXP lines, lines2; + int len, i, *t1, *t2; + + lines = findVarInFrame(R_Cov_freqs_hash, install(filename)); + if (lines == R_UnboundValue) { /* new file */ + lines = cov_new_lines_vector(line + 1); + defineVar(install(filename), lines, R_Cov_freqs_hash); + } + if (length(lines) <= line) { + /* lines vector too...

Readers, I have data with different time stamps that I wish to plot (for example): data set 1 time(hh:mm:ss),datum 01:00:00,500 01:00:15,600 01:00:30,750 01:00:45,720 01:01:00,700 01:01:15,725 01:01:30,640 01:01:45,710 data set 2 time,datum 01:00:12,20 01:01:01,55 01:01:55,22 The time interval in data set 1 does not change, but the time interval in data set 2 does change, such that for a

Dear all, I have following 2 zoo objects. However when I try to merge those 2 objects into one, nothing is coming as intended. Please see below the objects as well as the merged object: > dat11 V2 V3 V4 V5 2010-10-15 13:43:54 73.8 73.8 73.8 73.8 2010-10-15 13:44:15 73.8 73.8 73.8 73.8 2010-10-15 13:45:51 73.8 73.8 73.8 73.8 2010-10-15 13:46:21 73.8 73.8 73.8 73.8

I have two files with dates and prices in each. The number of rows in each of them will differ. How do I create a new file which contains data from both these files? Cbind and merge are not helpful. For cbind because the rows are not the same replication occurs. Also if I have similar data how do I write a vlookup kind of function? I am giving an example below: Say Price1 file contains the

Hi everyone, I'm writting a script that will open multiple files in a single folder and then will do some calculations to finally save everything in a big table. So here is the pseudo code #read all files in the given directory myfiles <-list.files("c:\\myDir") #initialize table ??? #loop through files for(f in myfiles[-1]) { netMat <-

Hi Using the ggplot2 package, I would like to obtain a plot that contains two time series that have data points on different dates. For instance, one data frame looks like: date1, value1 2010-01-05, 2921.74 2010-01-08, 2703.89 2010-01-14, 3594.21 2010-01-20, 3659.22 The other data frame looks like date2, value2 2010-01-01, 285.85 2010-01-02, 229.20 2010-01-05, 333.91 2010-01-06, 338.27

Readers, I have entered a file into r: ,column1,column2 row1,0.1,0.2 row2,0.3,0.4 using the command: dataframe<-read.table("/path/to/file.csv",header=T,row.names=1) When I try the command: dataframe[,2] I receive the response: NULL I was expecting: row1 0.2 row2 0.4 What is my error with the syntax please? Yours, r251 mandriva2009

I have a set of timestamp data that I have in a text file that I would like to import into R for analysis. The timestamps are formated as follows: DT_1,DT_2 [2006/08/10 21:12:14 ],[2006/08/10 21:54:00 ] [2006/08/10 20:42:00 ],[2006/08/10 22:48:00 ] [2006/08/10 20:58:00 ],[2006/08/10 21:39:00 ] [2006/08/04 12:15:24 ],[2006/08/04 12:20:00 ] [2006/08/04 12:02:00 ],[2006/08/04 14:20:00 ] I can get

Hi, I have been having very good results using plot.zoo to chart time series data. But I have three questions about plot.zoo and I am wondering if anyone knows the answers. (1) when I tried to use semi-log scale, via log="y", R issued a warning, although it looked like plot.zoo plotted in semi-log scale anyway: Warning message: In plot.xy(xy.coords(x, y), type = type, ...) :

I understand this is an easy question, and have been playing around with grep and the match function, but was hoping for a little incite: I have one .csv with the following data: names values A 1 B 2 C 3 D 4 The second .csv is: names A C I am hoping to match all of the rows that appear in the second .csv, making a new file that would look like this: names values

Hello, I have a question and need your help urgently. I am new to R but want to learn it. I have several files in a folder which I have imported to R using : temp = list.files(pattern="*.txt") >myfiles = lapply(temp, read.delim) The resulting files are on the workspace stored as List[110]. So they are 110 files in the list. Each file has several different columns and rows. My

trying to structure sql to merge two datasets. structure follows: dbs.possible.combos (all possible combinations of dates and places) Date Place 1/1/10 N-01 1/1/10 S-02 1/2/10 N-01 1/2/10 S-02 etc... dbs.aggregate (the raw data aggregated by date and location) Date Place Days 1/1/10 N-01 6 1/1/10 S-02 10 1/2/10 S-02 5 Trying to merge so I look-up the values for each possible combo dbs.final

Dear R-Users, Have a question about reading in some data and manipulating dates. I have a data set in excel which looks like this: Date PEG ETN HSP PTC 13/10/2004 41.92 64.75 29.86 9.27 14/10/2004 41.93 61.79 29.98 9.14 15/10/2004 41.69 62.7 30.09 9.04 18/10/2004