search for: jolc

...ess the code above as : Environment stats("package:stats") ; Function rnorm = stats.get( "rnorm" ) return rnorm( 10, 0.0 ) ; -- Romain Francois Professional R Enthusiast +33(0) 6 28 91 30 30 http://romainfrancois.blog.free.fr |- http://tr.im/KfKn : Rcpp 0.7.2 |- http://tr.im/JOlc : External pointers with Rcpp `- http://tr.im/JFqa : R Journal, Volume 1/2, December 2009

Un texte encapsul? et encod? dans un jeu de caract?res inconnu a ?t? nettoy?... Nom : non disponible URL : <https://stat.ethz.ch/pipermail/r-help/attachments/20100114/da4bc580/attachment.pl>

Hello, Could someone tell me, how can I select from a dataframe only those columns whose names contain a certain text? For example, if the column names are "Bond1.Creditclass","Bond1.Price","Bond2.Creditclass","Bond2.Price", how do I select only the columns corresponding to Bond1? Thanks a lot, Mihai [[alternative HTML version deleted]]

I have 6 or 7 nice constants (for example 1852 meters per nautical mile) I would like to have available to 4 or 5 functions in an R package. In C this would just be a header .h file and I would just "include" I am stuck trying to figure out how to create something like a C header file for an R package. Any ideas?

Dear R-help members, I'm quite new to R and I apologize for my basic question, but I haven't been able to find a solution yet. I try to interpret vector entries as a binary code, but unfortunately every first digit which is zero disappears. So how can I set any number (e.g. x = 10110) to a 8-digit zero fill-up (x = 00010110) in order to address digit indices? Or other way round, how

Could somebody let me know if there is nested name space supported? For example, is it possible to define a function in the name space 'nested_namespace' which is nested in the name space 'some_namespace'? some_namespace:::nested_namespace:::a_function() I checked Section 1.6 of R-exts.pdf. It seems that nested namespace is not supported, right?

Hello there, I want to create a string from strings and numbers, here is my code: str <- "name" & toString(20) but it returns me this error: Error in toString(20) : could not find function ".jcall" what did I do wrong? I couldn't find this error anywhere... -- View this message in context: http://n4.nabble.com/Error-with-toString-tp1290327p1290327.html Sent from

Hi, I need to read a string vector in R which is like this "atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my reading? Thanks, Beatriz -- View this message in context:

Hi the list, Is there a way to give a matrix to a C function, and then to use it as a matrix ? I write a function to print a matrix, but I use it as a vector : 1. void printMatrix(double *mTraj,int *nbCol, int *nbLigne){ 2. int i=0,j=0; 3. for(i=0 ; i < *nbLigne ; i++){ 4. for(j=0 ; j < *nbCol ; j++){ 5. Rprintf(" %f",mTraj[i * *nbCol + j]); 6. } 7.

Hi all, Is there a fast way to determine the number of lines in a file? I'm looking for something like count.lines analogous to count.fields. Hadley -- http://had.co.nz/

Hi the list, I need to write some efficient distances function, so I read the code for the Euclidean distance. I do not understand the purpose of the line 11 : if x[i] and y[i] are not NA (line 9), can dev be NA ? Christophe #define both_FINITE(a,b) (R_FINITE(a) && R_FINITE(b)) #define both_non_NA(a,b) (!ISNAN(a) && !ISNAN(b)) 1. static double R_euclidean2(double *x, double

I have been working on an R package that calls C code using .C(). I recently started including some functions from the GNU Scientific Library in my code. The code runs fine on my machine when not wrapped in the package. But I get the following error from "R CMD check" * checking whether the package can be loaded ... ERROR Loading required package: splancs Loading required package: sp

Hello All, I am trying to create a column of weights based off of factor levels from another column. I am using the weights to calculate L scores. Here is an example where the first column are scores, the second is my "factor" and the third I want to be a column of weights. I can do what I want with an ifelse statement (see below), but I am wondering if anyone knows of a cleaner way