Displaying 20 results from an estimated 57 matches for "gatting".
Did you mean:
natting
2012 Jun 25
2
setdiff datframes
hi,
I have 2 files example 1 and example 2 and would like to know what is in
example2 and not in example1 (attached)
V1 contain data which could be in duplicated which I am using as identifiers
I used setdiff(example2$V1,example1$V1) to find the identifiers which
are specific to example2:
[1] "rs2276598" "rs17253672"
I am looking for a way to get an output with all
2006 Aug 04
3
Help with short time series
Dear R-list,
I have a statistical problem with the comparison of two short time-series of
density data in an ecological framework. I have to compare two short time
series (5 years, one value for each year) of species density data (it is the
density of fish in two different streams) to test if the two means of the
five densities are significantly different, so basically if the two mean
2002 Oct 16
1
Error on startup
Hello,
could someone help me with this thing ?
gat@gat:~$wine /win/Programmi/WinMX/WinMX.exe
When you are running with a native NT directory specify
'Profile=<profiledirectory>' or disable loading of Windows
registry (LoadWindowsRegistryFiles=N)
fixme:ole:CoRegisterMessageFilter stub
fixme:ole:CoRegisterMessageFilter stub
gat@gat:~$
The last line of .wine/config contains:
2003 Jan 02
2
Icecast with WinAmp as a stramer
Hi,
I gat my streamer connected to to Icecast server, but whenever client try connect to icecast_server:8000, i gat msg "no encoder" in server console users was kicked-out. My client uses WinAmp, any clue?
---
CONFIDENTIALITY NOTICE & DISCLAIMER
This message and any attachments are solely intended for the addressee(s). It may also be Sapura Group's confidential,
2003 Jan 02
2
Icecast with WinAmp as a stramer
Hi,
I gat my streamer connected to to Icecast server, but whenever client try connect to icecast_server:8000, i gat msg "no encoder" in server console users was kicked-out. My client uses WinAmp, any clue?
---
CONFIDENTIALITY NOTICE & DISCLAIMER
This message and any attachments are solely intended for the addressee(s). It may also be Sapura Group's confidential,
2008 Feb 12
3
regular expression for na.strings / read.table
Dear all,
I am working with a csv file.
Some data of the file are not valid and they are marked with a star '*'.
For example : *789.
I have attached with this email a example file (test.txt) that looks like
the data I have to work with.
I see 2 possibilities ..thast I cannot manage anyway in R:
1-first & easiest solution:
Read the data with read.csv in R, and define as na strings
2005 Jul 29
2
Amavis on centos
I already have installed, postfix, squirrelmail, dovecot, spamassassin and
clamav.
The only thinks that I missed up is some interface between clamav ,
spamassassing and postfix, I am trying with amavis-new but I gat this error
when I try to install amavis from the tar file.
ERROR: MISSING REQUIRED BASIC MODULES:
IO::Wrap
IO::Stringy
Unix::Syslog
Mail::Field
Mail::Address
2010 Sep 20
3
Program looking for dll's
Hello,
I installed wine on ubuntu 10.04. I then installed Emsisoft Anti-Malware. When I go to run it I gat the following error.
david at david-ubuntu:~/.wine/drive_c/Program Files/Emsisoft Anti-Malware$ wine a2cmd.exe
fixme:reg:GetNativeSystemInfo (0x33fc6c) using GetSystemInfo()
fixme:service:QueryServiceObjectSecurity 0x13b768 4 0x1e2e8ec 0 0x1e2e8d8 - semi-stub
2005 Jul 29
1
amavis again
I am progressing with this but i still gat a problem.
. When I get to the step when I am supposed to install amavisd , I get the
following error message: Can't locate BerkeleyDB.pm in @INC (@INC contains:
/System/Library/Perl//darwin-2level /System/Library/Perl/
/Library/Perl//darwin-2level /Library/Perl/ /Library/Perl/
/Network/Library/Perl//darwin-2level /Network/Library/Perl/
2008 May 30
1
cannot use liberty office/terp office
I was downloading offices from sourceforge.net to test on Wine and to see if I liked one better that the ones that I was using now. Liberty Office launches then says that there is no parent window.
Terp office prints this in the console log.
Modules:
Module Address Debug info Name (11 modules)
PE 400000- 44e000 Export terp
PE 60b50000-60b54000 Deferred advapi32
PE
2011 Jan 21
1
help! complete the reviewer's suggest: carry out GA+GP (gaussian process)!
Hello, all experts,
My major is computer-aied drug design ( main QSAR).
Now, my paper need be reviesed, and one reviewer ask me do genetic algorithm
coupled with gaussian process method (GA+GP).
my data:
training set: 191*106
test set: 73*106
here, I need use GA+GP to do variable selection when building the model.
In R, there are not GA package like in matlab
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :(
I installed the seqinr library. I want to do an RSCU analysis.
But i can't get it to work in even the simplest case. for example, if i have
a string read in:
> newdata5
$testseq
[1] "agtgagatgatagatagatagatagatagatagatagaccccccagata"
and then i perform an RSCU analysis on it...
>
2015 Jul 06
2
Migration Samba3 -> Samba4: Accessing domain member server is not working
On 06/07/15 11:33, Roland Schwingel wrote:
>
> Thanks for your reply,
>
> Rowland Penny <rowlandpenny241155 at gmail.com> wrote on 06.07.2015
> 10:03:20:
>
> > > In the first 2 lines of the log I see the SIDs dumped.
> > > Both for my domain and for my member server.
> > >
> > > SID for local machine OSUSE-TEST is:
> > >
2017 Oct 25
2
'check password script' and Join...
Mandi! Andrew Bartlett via samba
In chel di` si favelave...
> Thanks for asking for clarification, I hope this puts you at ease.
Sure! Thanks to you!
Only a bit more:
> > PS: and domain members? How they enforce passwords policies? Directly
> > on AD DC, i suppose... but i'll ask. ;-)
> They don't ask the DC for the choice of local user passwords as far as
>
2013 May 22
5
Radio player for FirefoxOS
Hi, Emilis,
I have two working Icecast players which implement client-side parsing of
yp.xml and searching then through it:
- Python, can either transform the yp.xml into SQLite database and then
search inside, or can store the yp.xml locally and transfer in into DOM,
then search it.
http://www.zavedil.com/software-xbmc-icecast
- Java (Android), same algorithm as Python but only the SQLite
2013 Jun 25
1
Radio player for FirefoxOS
Hi, again,
is there any URL where I could POST to suggest streams for dir.xiph.org?
My users are demanding the ability to add their own stations to the app:
https://marketplace.firefox.com/app/world-radio-player/ratings
I would like to use their input (with their explicit consent) to push
data about new streams to dir.xiph.org.
On 06/10/2013 07:31 PM, "Thomas B. R?cker" wrote:
>
2012 Dec 25
3
ERROR : An error occurred while installing mysql2 (0.3.11), and Bundler cannot continue.
...*Gem::Installer::ExtensionBuildError:
ERROR: Failed to build gem native extension.*
it give me error : *
An error occurred while installing mysql2 (0.3.11), and Bundler cannot
continue.
Make sure that `gem install mysql2 -v ''0.3.11''` succeeds before bundling.*
Please help me to gatting out.
Thanks in advance
--
You received this message because you are subscribed to the Google Groups "Ruby on Rails: Talk" group.
To post to this group, send email to rubyonrails-talk-/JYPxA39Uh5TLH3MbocFF+G/Ez6ZCGd0@public.gmane.org
To unsubscribe from this group, send email to rubyon...
2017 Apr 14
2
Possible bug with latest 7.3 installer, md RAID1, and SATADOM.
I'm seeing a problem that I think maybe a bug with the mdraid software on the latest CentOS installer. I have a couple of new supermicro servers and each system has two innodisk 32GB SATADOM's that are experiencing the same issue. I used the latest CentOS-7-x86_64-1611 to install to the two SATADOM's a simple RAID1 for the root. The install goes just fine but when I boot off the new
2021 Dec 08
3
Qemu - enabling "bridge mode" for primary physical interface for VMs
Once upon a time, Lists <lists at benjamindsmith.com> said:
> I understand that it's possible to allow the 4 VM guest systems to each have a
> "direct" fixed IP address and access the addresses \via the host network
> adapter, while the host retains its fixed IP.
If you are running NetworkManager (the default), it's not too hard.
Here's an example
2017 Oct 25
0
'check password script' and Join...
On Wed, 25 Oct 2017 16:21:03 +0200
Marco Gaiarin via samba <samba at lists.samba.org> wrote:
> Mandi! Andrew Bartlett via samba
> In chel di` si favelave...
>
> > Thanks for asking for clarification, I hope this puts you at ease.
>
> Sure! Thanks to you!
>
>
> Only a bit more:
>
> > > PS: and domain members? How they enforce passwords