search for: gat

Displaying 20 results from an estimated 57 matches for "gat".

Did you mean: at
2012 Jun 25
2
setdiff datframes
...3 7 SYNONYMOUS_CODING 365 27 9 P ccC/ccT rs41284843 8 NMD_TRANSCRIPT,SYNONYMOUS_CODING 264 27 9 P ccC/ccT rs41284843 9 NON_SYNONYMOUS_CODING 1330 1173 391 I/M atA/atG rs3729680 10 NON_SYNONYMOUS_CODING 1468 1064 355 G/D gGt/gAt rs61744960 11 NON_SYNONYMOUS_CODING 1204 1064 355 G/D gGt/gAt rs61744960 12 NON_SYNONYMOUS_CODING 1924 1064 355 G/D gGt/gAt rs61744960 13 NON_SYNONYMOUS_CODING 1924 1064 355 G/D gGt/gAt rs61744960 14 NON_SYNONYMOUS_CODING 1450 1064...
2006 Aug 04
3
Help with short time series
Dear R-list, I have a statistical problem with the comparison of two short time-series of density data in an ecological framework. I have to compare two short time series (5 years, one value for each year) of species density data (it is the density of fish in two different streams) to test if the two means of the five densities are significantly different, so basically if the two mean
2002 Oct 16
1
Error on startup
Hello, could someone help me with this thing ? gat@gat:~$wine /win/Programmi/WinMX/WinMX.exe When you are running with a native NT directory specify 'Profile=<profiledirectory>' or disable loading of Windows registry (LoadWindowsRegistryFiles=N) fixme:ole:CoRegisterMessageFilter stub fixme:ole:CoRegisterMessageFilter stub gat@gat:~$...
2003 Jan 02
2
Icecast with WinAmp as a stramer
Hi, I gat my streamer connected to to Icecast server, but whenever client try connect to icecast_server:8000, i gat msg "no encoder" in server console users was kicked-out. My client uses WinAmp, any clue? --- CONFIDENTIALITY NOTICE & DISCLAIMER This message and any attachments...
2003 Jan 02
2
Icecast with WinAmp as a stramer
Hi, I gat my streamer connected to to Icecast server, but whenever client try connect to icecast_server:8000, i gat msg "no encoder" in server console users was kicked-out. My client uses WinAmp, any clue? --- CONFIDENTIALITY NOTICE & DISCLAIMER This message and any attachments...
2008 Feb 12
3
regular expression for na.strings / read.table
...("\\*",DATA,value=T))==0)) > DATA X1 X.789 LNM. X78 X56 X89 X56.1 X100 1 2 700 AUW 78 56 89 56 100 2 3 400 TOC 78 56 89 56 10 3 4 389 RMN 78 56 89 56 *89 4 5 400 LNM 78 56 *452 56 100 5 6 200 UTC 78 *40 89 56 100 6 7 100 GAT 78 56 8 56 *100 7 8 79 *LNM 78 56 9 56 100 8 9 89 TCG 78 56 800 56 *100 9 10 78* LNM 78 56 89 56 100 ...but which would work (Stars are still there)! Do anyone knows how to do that ? 2-Second solution: - first read the file with DATA<-read.csv("...
2005 Jul 29
2
Amavis on centos
I already have installed, postfix, squirrelmail, dovecot, spamassassin and clamav. The only thinks that I missed up is some interface between clamav , spamassassing and postfix, I am trying with amavis-new but I gat this error when I try to install amavis from the tar file. ERROR: MISSING REQUIRED BASIC MODULES: IO::Wrap IO::Stringy Unix::Syslog Mail::Field Mail::Address Mail::Header Mail::Internet Compress::Zlib MIME::Words MIME::Head MIME::Body MIME::Entity MIME::Pa...
2010 Sep 20
3
Program looking for dll's
Hello, I installed wine on ubuntu 10.04. I then installed Emsisoft Anti-Malware. When I go to run it I gat the following error. david at david-ubuntu:~/.wine/drive_c/Program Files/Emsisoft Anti-Malware$ wine a2cmd.exe fixme:reg:GetNativeSystemInfo (0x33fc6c) using GetSystemInfo() fixme:service:QueryServiceObjectSecurity 0x13b768 4 0x1e2e8ec 0 0x1e2e8d8 - semi-stub fixme:service:QueryServiceObjectSecu...
2005 Jul 29
1
amavis again
I am progressing with this but i still gat a problem. . When I get to the step when I am supposed to install amavisd , I get the following error message: Can't locate BerkeleyDB.pm in @INC (@INC contains: /System/Library/Perl//darwin-2level /System/Library/Perl/ /Library/Perl//darwin-2level /Library/Perl/ /Library/Perl/ /Network/Lib...
2008 May 30
1
cannot use liberty office/terp office
...2 PE 622c0000-622d2000 Deferred comctl32 PE 626a0000-626a4000 Deferred ole32 PE 62790000-62794000 Deferred rpcrt4 PE 7b810000-7b87c000 Export kernel32 PE 7bc10000-7bc14000 Deferred ntdll Threads: process tid prio (all id:s are in hex) 00000008 (D) Z:\Users\gat\Desktop\Terp.exe 00000009 0 <== 0000000c 00000014 0 00000013 0 00000012 0 0000000e 0 0000000d 0 0000000f 00000016 0 00000015 0 00000011 0 00000010 0 Backtrace: =>1 0x00419b5d in terp (+0x19b5d) (0x0032ff2c) 2 0x00448695 in terp (+0x48695) (0x0032ff4...
2011 Jan 21
1
help! complete the reviewer's suggest: carry out GA+GP (gaussian process)!
...do genetic algorithm coupled with gaussian process method (GA+GP). my data: training set: 191*106 test set: 73*106 here, I need use GA+GP to do variable selection when building the model. In R, there are not GA package like in matlab GA-toolbox(http://www.sheffield.ac.uk/acse/research/ecrg/gat.html) . now, I just can use the matlab GA-tool box, however, I can not use GP-toolbox in matlab. so I search the internet, find R package "genalg" can do GA. and an example given is to do wavelength selection by GA+PLS, so I think i certainly do the GA+GP. unfortunately, in this genalg p...
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... > uco(newdata5,index="rscu") aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag cat NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA...
2015 Jul 06
2
Migration Samba3 -> Samba4: Accessing domain member server is not working
On 06/07/15 11:33, Roland Schwingel wrote: > > Thanks for your reply, > > Rowland Penny <rowlandpenny241155 at gmail.com> wrote on 06.07.2015 > 10:03:20: > > > > In the first 2 lines of the log I see the SIDs dumped. > > > Both for my domain and for my member server. > > > > > > SID for local machine OSUSE-TEST is: > > >
2017 Oct 25
2
'check password script' and Join...
...#39;'copying'' expiration date from Samba/Windows ones, so i've addedd NSS 'shadow' ldap context and the POSIX layer are aware of password expiration. I supposed now that password are checked against DC in a ''black/white'' way, eg if i try to authenticate i gat something like: a) good b) bad password c) password expired, please change d) account disabled Right? No one have tried to add 'shadow' context in winbind? I'm simply curious... ;-) Again, thanks. -- dott. Marco Gaiarin GNUPG Key ID: 240A3D66 Associazione ``La No...
2013 May 22
5
Radio player for FirefoxOS
Hi, Emilis, I have two working Icecast players which implement client-side parsing of yp.xml and searching then through it: - Python, can either transform the yp.xml into SQLite database and then search inside, or can store the yp.xml locally and transfer in into DOM, then search it. http://www.zavedil.com/software-xbmc-icecast - Java (Android), same algorithm as Python but only the SQLite
2013 Jun 25
1
Radio player for FirefoxOS
...>> >>> Cheers >>> >>> Thomas >> >> >> -- >> Emilis Dambauskas >> >> emilis.d at gmail.com >> gsm: +370-686-07732 >> http://emilis.info/ >> >> -----BEGIN GEEK CODE BLOCK----- >> Version: 3.12 >> GAT/CC/MC/GG/O dpu(-) s:+ a C++ UBLHS++ P(+) L+++ E-(++) W+++$ N+ o-- K? !w O? M-@ V? PS+(--) PE Y+>++ PGP>+ t- 5? X+@ R- !tv b+ DI++++ D+ G e++ h----(*) r+++ y++++ >> ------END GEEK CODE BLOCK------ >> > -- Emilis Dambauskas emilis.d at gmail.com gsm: +370-686-07732 http://em...
2012 Dec 25
3
ERROR : An error occurred while installing mysql2 (0.3.11), and Bundler cannot continue.
...*Gem::Installer::ExtensionBuildError: ERROR: Failed to build gem native extension.* it give me error : * An error occurred while installing mysql2 (0.3.11), and Bundler cannot continue. Make sure that `gem install mysql2 -v ''0.3.11''` succeeds before bundling.* Please help me to gatting out. Thanks in advance -- You received this message because you are subscribed to the Google Groups "Ruby on Rails: Talk" group. To post to this group, send email to rubyonrails-talk-/JYPxA39Uh5TLH3MbocFF+G/Ez6ZCGd0@public.gmane.org To unsubscribe from this group, send email to ru...
2017 Apr 14
2
Possible bug with latest 7.3 installer, md RAID1, and SATADOM.
I'm seeing a problem that I think maybe a bug with the mdraid software on the latest CentOS installer. I have a couple of new supermicro servers and each system has two innodisk 32GB SATADOM's that are experiencing the same issue. I used the latest CentOS-7-x86_64-1611 to install to the two SATADOM's a simple RAID1 for the root. The install goes just fine but when I boot off the new
2021 Dec 08
3
Qemu - enabling "bridge mode" for primary physical interface for VMs
...by-step for changing an existing interface "em1" to be a bridge "br0": # Create a bridge interface nmcli con add type bridge ifname br0 bridge.stp no # Copy all the IPv4/IPv6 config from an existing interface nmcli con mod bridge-br0 $(nmcli -f ipv4.method,ipv4.addresses,ipv4.gateway,ipv6.method,ipv6.addresses,ipv6.gateway con show em1 | grep -v -- -- | sed 's/: */ /') # -or- just set an IPv4 address/gateway to known values nmcli con mod bridge-br0 ipv4.method manual ipv4.address 10.1.1.2/24 ipv4.gateway 10.1.1.1 ipv6.method ignore # Make a connection for the phys...
2017 Oct 25
0
'check password script' and Join...
...; expiration date from Samba/Windows ones, so i've > addedd NSS 'shadow' ldap context and the POSIX layer are aware of > password expiration. > > I supposed now that password are checked against DC in a > ''black/white'' way, eg if i try to authenticate i gat something like: > a) good > b) bad password > c) password expired, please change > d) account disabled > > Right? > Yes > > No one have tried to add 'shadow' context in winbind? I'm simply > curious... ;-) > If you mean adding 'winbind'...