search for: gac

Displaying 20 results from an estimated 45 matches for "gac".

Did you mean: ac
2019 Sep 18
3
Change in behaviour for the "%U" substitution in 4.10.8?
...d usershares. If you use \\server.fqdn\users\ ( per example from the [users] share. Can you can set in RSAT \\server.fqdn\users\%username% And now windows creates the homedir and this works the same for profiles. Just saying.. Greetz, Louis ________________________________ Van: gac [mailto:gac at tutanota.com] Verzonden: dinsdag 17 september 2019 17:56 Aan: L.P.H. van Belle CC: samba at lists.samba.org Onderwerp: Re: [Samba] Change in behaviour for the "%U" substitution in 4.10.8? I found the same bug, and discounted it as irrelevant...I can't see the...
2019 Sep 18
0
Change in behaviour for the "%U" substitution in 4.10.8?
...at least not yet. ? > However the other share that uses the "%U" substitution in its path still does not work because it's looking for the wrong path on the server.? Have you tried to replace?%U in the path off?the?not working share with ?%u? ? ? ? ? Greetz, ? Louis ? ? Van: gac [mailto:gac at tutanota.com] Verzonden: woensdag 18 september 2019 11:56 Aan: L.P.H. van Belle CC: samba at lists.samba.org Onderwerp: Re: [Samba] Change in behaviour for the "%U" substitution in 4.10.8? OK, I did what you suggested, and the [homes] share worked. I played around with...
2019 Sep 18
3
Change in behaviour for the "%U" substitution in 4.10.8?
I have now - the 'net view' output is now sensible, and reports "Time Machine for gac" (which is the expected comment). But in log.smbd, it is now looking for a folder called "/backups/timemachine/DOMAIN\username" so access to the share itself is still not working 18 Sep 2019, 11:54 by samba at lists.samba.org: > Have you tried to replace?%U in the path off?the?...
2019 Sep 17
0
Change in behaviour for the "%U" substitution in 4.10.8?
...w about you system and setup. https://raw.githubusercontent.com/thctlo/samba4/master/samba-collect-debug-info.sh ? Then set debug level 10 and try again. if you can pm me the logs, compress them and attach them. ? I'll have a look that is happening there. ? ? Greetz, ? Louis ? ? ? ? ? Van: gac [mailto:gac at tutanota.com] Verzonden: dinsdag 17 september 2019 15:41 Aan: gac CC: L.P.H. van Belle; samba at lists.samba.org Onderwerp: Re: [Samba] Change in behaviour for the "%U" substitution in 4.10.8? I downgraded the packages to 4.10.7 The issue is fixed; the two shares I u...
2019 Sep 17
0
Change in behaviour for the "%U" substitution in 4.10.8?
.../samba-collect-debug-info.sh > ? > Then set debug level 10 and try again. > if you can pm me the logs, compress them and attach them. > ? > I'll have a look that is happening there. > ? > ? > Greetz, > ? > Louis > ? > ? > ? > ? > ? > > Van: gac [mailto:gac at tutanota.com] > Verzonden: dinsdag 17 september 2019 15:41 > Aan: gac > CC: L.P.H. van Belle; samba at lists.samba.org > Onderwerp: Re: [Samba] Change in behaviour for the "%U" substitution in 4.10.8? > > > > I downgraded the packages to 4.10.7 >...
2019 Sep 18
2
Change in behaviour for the "%U" substitution in 4.10.8?
...Windows 7 laptop on my desk at the moment which is bound to the same AD domain as the troublesome server and is showing the same symptoms. I'll pick up some log fragments tomorrow, I'm not in the office right now? 18 Sep 2019, 16:52 by samba at lists.samba.org: > On 18/09/2019 16:39, gac via samba wrote: > >> I have now - the 'net view' output is now sensible, and reports "Time Machine for gac" (which is the expected comment). But in log.smbd, it is now looking for a folder called "/backups/timemachine/DOMAIN\username" so access to the share its...
2019 Sep 06
3
Change in behaviour for the "%U" substitution in 4.10.8?
..., path /shares/DOMAIN/domain_username Thanks for all your advice so far but I still don't believe this is a permissions problem, Samba is trying to access a directory which simply does not exist, and never has existed... 6 Sep 2019, 11:19 by samba at lists.samba.org: > On 06/09/2019 11:12, gac wrote: > >> I imagine the numeric UID is my old boss who left the company a few years ago, and by this point his account has been removed, not just disabled. The only thing contained by the DOMAIN directory is a home directory for each user, which is owned by them. So I don't _think_ t...
2019 Sep 17
1
Change in behaviour for the "%U" substitution in 4.10.8?
...in with 4.10.7 on a local repo. You can find them here. http://downloads.van-belle.nl/samba4/ The 4.10.7 for Stretch Buster and Bionic source and deb's are there to get. Greetz, Louis > -----Oorspronkelijk bericht----- > Van: samba [mailto:samba-bounces at lists.samba.org] Namens gac via samba > Verzonden: dinsdag 17 september 2019 12:49 > Aan: Samba > Onderwerp: Re: [Samba] Change in behaviour for the "%U" > substitution in 4.10.8? > > This is unfortunately still happening - anyone else have any > other ideas? > > As a reminder/summary...
2019 Sep 06
2
Change in behaviour for the "%U" substitution in 4.10.8?
...t path --- [2019/09/06 09:43:14.955067,? 0] ../../source3/smbd/service.c:784(make_connection_snum) ? make_connection_snum: canonicalize_connect_path failed for service username, path /shares/DOMAIN/domain_username --- Thanks 6 Sep 2019, 09:31 by samba at lists.samba.org: > On 06/09/2019 09:11, gac via samba wrote: > >> No problem - I've pastebin'ed it rather than include it, I don't know what this list's preferences are for config files.?https://pastebin.com/70vTmWyL <https://pastebin.com/70vTmWyL> >> >> Note that there's a lot of lines in there...
2019 Sep 17
1
Change in behaviour for the "%U" substitution in 4.10.8?
...4/ >> The 4.10.7 for Stretch Buster and Bionic source and deb's are there to get. >> >> >> Greetz, >> >> Louis >> >> >> >>> -----Oorspronkelijk bericht----- >>> Van: samba [mailto:samba-bounces at lists.samba.org] Namens gac via samba >>> Verzonden: dinsdag 17 september 2019 12:49 >>> Aan: Samba >>> Onderwerp: Re: [Samba] Change in behaviour for the "%U" >>> substitution in 4.10.8? >>> >>> This is unfortunately still happening - anyone else have any >...
2019 Sep 06
2
Change in behaviour for the "%U" substitution in 4.10.8?
No problem -?https://pastebin.com/G8pa3bdE <https://pastebin.com/G8pa3bdE> 6 Sep 2019, 10:28 by samba at lists.samba.org: > On 06/09/2019 09:47, gac wrote: > >> I opted for 'remove the SERVER lines' (since I don't remember why they are in there) - but this hasn't changed the behaviour. The log file contains a different error message, but still refers to the incorrect path >> >> --- >> [2019/09/06 09:43...
2001 Oct 08
2
Rcmd
...postscript device, and bringToTop does not make sense with that device. Howevere, my function is for interactive use, and needs bringToTop. How can this be used in examples and still have the possibility to use the automatic error checking? I also used par(ask=TRUE) and identify in examples, but gac ve up on that. But there is a general problem that the automatic running of example code chocks on code which make sense interactively, but not in batch mode. How can this be solved? Also, it would be nice if the control of exampkles would not stop on the first error, but control with further ex...
2019 Sep 06
2
Change in behaviour for the "%U" substitution in 4.10.8?
...rns: winbind_lookup_rids failed: WBC_ERR_DOMAIN_NOT_FOUND The ACLs are to allow --x access for the 'www-data' into users home directories for use with Apache+mod_userdir, and then r-x access for their www directory 6 Sep 2019, 10:52 by samba at lists.samba.org: > On 06/09/2019 10:34, gac wrote: > >> No problem - https://pastebin.com/G8pa3bdE >> > Please just post things like this in line ;-) > > root at server:/var/log/samba# ls -lad /shares > drwxr-xr-x 9 root root 4096 Jan 16? 2019 /shares # > > Owner:Group is root:root, but anybody can enter >...
2006 May 17
2
rsync option for continuing event i/o errors occured on remove server
...rsion rsync version 2.5.7 protocol version 26 Copyright (C) 1996-2002 by Andrew Tridgell and others <http://rsync.samba.org/> Capabilities: 64-bit files, socketpairs, hard links, symlinks, batchfiles, IPv6, 64-bit system inums, 64-bit internal inums Thanks -- Gabriel CORRE gac@4js.com - Four J's Development Tools - www.4js.com
2019 Sep 06
0
Change in behaviour for the "%U" substitution in 4.10.8?
Have you tried running net cache flush after you have removed the SERVER lines from you config? Regards Am 06.09.19 um 12:33 schrieb gac via samba: > I've now changed the ownership to root, as you suggest. > > I've removed the ACLs from /shares/DOMAIN - they don't need to be there as anyone can enter this directory already so there's no need for them. > > The ACLs on my individual home directory: &gt...
2019 Sep 18
0
Change in behaviour for the "%U" substitution in 4.10.8?
On 18/09/2019 16:39, gac via samba wrote: > I have now - the 'net view' output is now sensible, and reports "Time Machine for gac" (which is the expected comment). But in log.smbd, it is now looking for a folder called "/backups/timemachine/DOMAIN\username" so access to the share itself is st...
2019 Sep 06
2
Change in behaviour for the "%U" substitution in 4.10.8?
...> Yesterdays subject "Samba, Time Machine, and ADS" > Replied that if working now for him, so whats the the difference here. > > > Greetz, > > Louis > >> -----Oorspronkelijk bericht----- >> Van: samba [mailto:samba-bounces at lists.samba.org] Namens gac via samba >> Verzonden: vrijdag 6 september 2019 9:29 >> Aan: samba at lists.samba.org >> Onderwerp: [Samba] Change in behaviour for the "%U" >> substitution in 4.10.8? >> >> Hi knowledgable Samba folks, >> I have a Samba server (Ubuntu 18.04, wi...
2019 Sep 17
0
Change in behaviour for the "%U" substitution in 4.10.8?
...ame behaviour. > > 6 Sep 2019, 11:49 by samba at lists.samba.org: > >> Have you tried running >> >> net cache flush >> >> after you have removed the SERVER lines from you config? >> >> Regards >> >> >> Am 06.09.19 um 12:33 schrieb gac via samba: >> >>> I've now changed the ownership to root, as you suggest. >>> >>> I've removed the ACLs from /shares/DOMAIN - they don't need to be there as anyone can enter this directory already so there's no need for them. >>> >>&gt...
2012 Feb 29
1
codon usage bias
Hey guys, I have what i think is a really simple problem :( I installed the seqinr library. I want to do an RSCU analysis. But i can't get it to work in even the simplest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... > uco(newdata5,index="rscu") aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag cat NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA cca ccc ccg cct cga cgc cgg cg...
2006 Aug 08
10
Can I integrate Ruby on Rails with Microsoft COM (Quickbooks specifically)
Please help if anybody knows the answer! I''m just starting to learn Ruby on Rails. I''m working my way through the Agile Web Development with Rails book. I have been offered a project that I''d like to do with Rails for a not-for-profit organization. However, the person who I would be doing it for would like the application to integrate with their Quickbooks system