search for: exdata

Hello! Someone know what are the difference between R and S-PLUS in the density() function? For example, I would like to reply this simple S-PLUS code in R, but I don't understand which parameter I should modify to get the same results. S-PLUS CODE: density(1:1000, width = 4) R-CODE: density(1:1000, bw = 4, window = "g", n = 50, cut = 0.75) I obtain the same x values, but

...r time series, or use the rollapply function in zoo? I have a set of dates where I want to check if there has been an event 14 days prior to each time point in order to mark these timepoints for removal, and can't figure out a good way to do it. Many thanks in advance! Gustaf Example data: exData<-structure(list(Datebegin = structure(c(14476, 14569, 14576, 14621, 14627, 14632, 14661, 14671, 14705, 14715, 14751, 14756, 14495, 14518, 14523, 14526, 14528, 14529, 14545, 14548), class = "Date"), Event = c(TRUE, FALSE, FALSE, FALSE, FALSE, FALSE, FALSE, FALSE, FALSE, FALSE, T...

...model for log odds that Y=1 > L <- .4*(sex=='male') + .045*(age-50) + + (log(cholesterol - 10)-5.2)*(-2*(sex=='female') + 2*(sex=='male')) > # Simulate binary y to have Prob(y=1) = 1/[1+exp(-L)] > y <- ifelse(runif(n) < plogis(L), 1, 0) > > exdata <- data.frame(y=y,age=age,blood.pressure=blood.pressure,cholesterol=cholesterol,sex=sex) > > ### > ### Example > ### > > fit1 <- lrm(y ~ blood.pressure + sex * age + cholesterol, data = exdata) > fit2 <- lrm(y ~ blood.pressure + age + sex * cholesterol, data =...

...mmary(soapfeel.mod[["gee"]]) GEE: GENERALIZED LINEAR MODELS FOR DEPENDENT DATA gee S-function, version 4.13 modified 98/01/27 (1998) Model: Link: Logit Variance to Mean Relation: Binomial Correlation Structure: Fixed Call: ogee(formula = formula, id = exdata$exdata$subjects, data = exdata$exdata, R = R_mat, b = as.numeric(coeffs), maxiter = 10, family = "binomial", corstr = "fixed", silent = TRUE, scale.fix = TRUE, scale.value = scalevalue) Summary of Residuals: Min 1Q Median 3Q Max...

...m nonparametric regression using bandwidth2 results2 <- npreg(bws=bandwidth2) summary(results2) # use plot to plot results # note that the plot is not limited to points where x1>=x2 plot(results2,view="fixed",theta=300) evaluate <- data.frame(x1=mydata2$x1>=mydata2$x2) # use exdata option to specify the set of (x1,x2) points # note that this produces exactly the same plot plot(results2,exdata=evaluate,view="fixed",theta=300) # try specifying the evalution points in npreg itself results3 <- npreg(bws=bandwidth2,exdata=evaluate) summary(results3) # the results are...

...GAGGGCCCTACA > 341727 963859 GGTGCAGTTCGACTCTAAGTTTGCT > 341728 963863 AAACACGGTTATTCATCTGCGAAAC > 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA > 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA > > getwd() > [1] "C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi > cells/exData"} > > {library(oligo) > > celFiles<-list.celfiles("exData", full.names=TRUE) > > affyCit<-read.celfiles("GSM839728_GF_28mm_EC-1.CEL", > "GSM839729_GF_28mm_EC-2.CEL", "GSM839730_GF_28mm_EC-3.CEL", > "GSM839731_GF_28mm_PC...

On Mon, 2015-08-17 at 14:13 +0200, Stephan Bosch wrote: > but until then you can avoid this by using the the exdata hg revision before tip > (57c8d3e6b562). Great, thanks for the quick reply, that fixed the compilation problem. I'm still getting a segfault though. This time the backtrace is: Using host libthread_db library "/lib/x86_64-linux-gnu/libthread_db.so.1". Core was generated by `dov...

hey all, I'm just getting used to R and i'm having issues when it comes to reading my data in rows rather than columns. any good advice would be much appreciated ! here is the error: > data1 <- read.table(file.choose(),header=T) > x1 <- c(data1[1,1:5]) > shapiro.test(x1) Error in sort.int(x, na.last = na.last, decreasing = decreasing, ...) : 'x' must be atomic

On Thu, 2015-08-06 at 16:10 +0200, Stephan Bosch wrote: > Since the extdata plugin is not part of the normal Debian packages (not > afaik anyway), you likely compiled and installed the extdata plugin > manually in the past while using Dovecot 2.1. Do that again, but use > this repository: http://hg.rename-it.nl/pigeonhole-0.4-sieve-extdata/ I'm just trying to install this now,

...ion support (much like Dovecot itself already has for its plugins). This is the last change in the pigeonhole-0.4-sieve-extdata plugin repository. There is no Pigeonhole release for this yet (and adoption in Debian will likely take some time), but until then you can avoid this by using the the exdata hg revision before tip (57c8d3e6b562). Regards, Stephan.

Andrew Beverley schreef op 17-8-2015 om 14:35: > On Mon, 2015-08-17 at 14:13 +0200, Stephan Bosch wrote: >> but until then you can avoid this by using the the exdata hg revision before tip >> (57c8d3e6b562). > Great, thanks for the quick reply, that fixed the compilation problem. > > I'm still getting a segfault though. This time the backtrace is: Still looks like the executed extdata plugin was compiled against a different pigeonhole. That...

Hi All, I have a dataset with a column named "Condition", Sample Condition 1 c20 2 c20 3 c10 4 c10 5 c9 6 c9 7 c5 8 c5 9 c20 10 c10 Could you let me know the fastest way to change c20->"AA", c20->"BB", c9->"CC", c5->"DD"