search for: dnastring

Dear List, I tested the example in the reposTools vignette: library(reposTools); Loading required package: tools genRepos("Test Repository", "http://biowww.dfci.harvard.edu/~jgentry/","newRepos"); Error in rep.int(colnames(x), nr) : unimplemented type 'NULL' in 'rep' Could someone help me out with this one? I'd appreciate all help.... I am

Hiya, I am trying to look at the similarities between a number of sequences, for example i am trying to see how similar "ababbbassdaa" is to "addffggssbbsbbs" I was wondering is the some way for me to see how similar they are in terms of, for example, number of a's, number of b's, how often a and ab are consecutive, how often abab is together etc. Any advice

...indels contained in it? This seems arbitrary and also misleading, because it always gives a false impression that there are no indels. Could the return data types consistently be made to be IRanges ? Sometimes it's IntegerList, sometimes it's IRanges. For example, > A 11-letter "DNAString" instance seq: GAACGAGGACC > B 8-letter "DNAString" instance seq: GGACGAGC > alignment <- pairwiseAlignment(A, B, gapOpening = 0, gapExtension = 1, substitutionMatrix = substitutions) > alignment at subject@mismatch IntegerList of length 1 [[1]] 2 > alignment at subj...

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

...s which match real genes #(add this onto stefans script … req to buid the gr object using the regions from the BSgenome alignment of the 100bp seqs.) txdb <- makeTranscriptDbFromUCSC(genome = "hg19", tablename = "knownGene") ## do once locally & save #query.plus <- DNAString("DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD") # 100bp C free sequence query.plus <- DNAString("DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD") # 60bp C free sequence query.minus <- reverseComplement(q...

...ot;cleanup extra prompts left in output" is over-aggressive and will trim session :output at lines consisting exclusively of blanks and periods such as produced when printing a BioConductor 'Views' object which wants to appear as #+RESULTS: #+begin_example Views on a 23011544-letter DNAString subject subject: CGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCCCATATTATAGGGAGAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTTTGATTTTTTGGCAACCCAAAATGGTGGCGGATGAACGAGATGATAATATATTCAAGTTGCCGCTAATCAGAAATAAATTCATTGCAACGTTAAATACAGCACAATATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTAATGAGTGCCTCTCGTT...

Hi, I have a string "GGGGGGCCCAATCGCAATTCCAATT" What I want to do is to count the percentage of each letter in the string, what string functions can I use to count the number of each letter appearing in the string? For example, the letter "A" appeared 6 times, letter "T" appeared 5 times, how can I use a string function to get the these number? thanks, karena