Displaying 20 results from an estimated 79 matches for "daren".
Did you mean:
darren
2008 Jul 08
4
Can R do this ?
I have a folder full of pngs and jpgs, and would like to consolidate them into a pdf with appropriate title and labels. Can this be done via R ?
_________________________________________________________________
Easily publish your photos to your Spaces with Photo Gallery.
[[alternative HTML version deleted]]
2008 Jun 19
4
Any simple way to subset a vector of strings that do contain a particular substring ?
For example,
strings <- c("aaaa", "bbbb","ccba").
How to get "aaaa", "bbbb" that do not contain "ba" ?
_________________________________________________________________
[[alternative HTML version deleted]]
2008 Jul 15
5
counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"
Any better solution than this ?
sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G")
_________________________________________________________________
[[alternative HTML version deleted]]
2008 Jul 31
4
Identifying common prefixes from a vector of words, and delete those prefixes
For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ?
Thanks
_________________________________________________________________
[[alternative HTML version deleted]]
2009 Mar 24
3
Summarizing each row into a frequency table
I have a matrix containing -1, 0, 1, however certain rows will not
have all 3 numbers. I have written some codes to compute the frequency
table of how many -1s, 0s, 1s per row, but it is very ugly and not
efficient if there are more than 3 numbers. Please suggest.
m <- rbind(sample(0:1, replace=T, 10), sample(-1:1, replace=T, 10))
m.table <- t(apply(m, 1, function(x) c(sum(x==-1, na.rm=T),
2008 Jun 10
2
Fast method to compute average values of duplicated IDs
Hi,
How do I collapse (average in the simplest case) the values of those duplicated ids (i.e., 2, 5, 6, 9) to give a table of unique ids ?
t <- cbind(id=c(1:10, 2,5,6,9), value=rnorm(14))
_________________________________________________________________
[[alternative HTML version deleted]]
2008 Jun 25
3
selecting values that are unique, instead of selecting unique values
unique(c(1:10,1)) gives 1:10 (i.e. unique values), is there any method to get only 2:10 (i.e. values that are unique) ?
_________________________________________________________________
Easily edit your photos like a pro with Photo Gallery.
[[alternative HTML version deleted]]
2009 Jan 06
2
Generating GUI for r-scripts
Hi,
I have developed some scripts that basically ask for input tab-limited format files, do some processing, and output several pictures or csv. Now I need to have some gui to wrap on top of the scripts, so that end-users can select their input files, adjust some parameters for processing, and select output folder or filenames.
Please advice me if there is any tools or project suitable for
2008 Sep 13
3
Beautify R scripts in microsoft word
I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ?
Thanks
_________________________________________________________________
[[alternative HTML version deleted]]
2008 Jan 05
11
Help with booting dom0 on a Dell 2950
...o the point where it displays the uname info and then just stays there. It will not boot past that point. I have enabled VT technology in the BIOS (but only after the installation).
Where/what can I look at to trouble shoot this? I am new to xen and would like to try and start trying it out.
TIA,
Daren
This message posted from opensolaris.org
2008 Dec 03
2
Speeding up casting a dataframe from long to wide format
Hi,
I am casting a dataframe from long to wide format. The same codes that works for a smaller dataframe would take a long time (more than two hours and still running) for a longer dataframe of 2495227 rows and ten different predictors. How to make it more efficient ?
wer <- data.frame(Name=c(1:5, 4:5), Type=c(letters[1:5], letters[4:5]), Predictor=c("A", "A",
2008 Nov 26
2
Very slow: using double apply and cor.test to compute correlation p.values for 2 matrices
My two matrices are roughly the sizes of m1 and m2. I tried using two apply and cor.test to compute the correlation p.values. More than an hour, and the codes are still running. Please help to make it more efficient.
m1 <- matrix(rnorm(100000), ncol=100)
m2 <- matrix(rnorm(10000000), ncol=100)
cor.pvalues <- apply(m1, 1, function(x) { apply(m2, 1, function(y) { cor.test(x,y)$p.value
2008 Aug 05
0
Re: away
i am currently not in singapore from the 6th to 10th Aug 2008. For anything urgent, please contact Daren at daren@hwzcorp.com
Thanks.
Best Regards,
Choon Kiat
_______________________________________________
Xen-users mailing list
Xen-users@lists.xensource.com
http://lists.xensource.com/xen-users
2008 Aug 07
0
Re: away
i am currently not in singapore from the 6th to 10th Aug 2008. For anything urgent, please contact Daren at daren@hwzcorp.com
Thanks.
Best Regards,
Choon Kiat
_______________________________________________
Xen-users mailing list
Xen-users@lists.xensource.com
http://lists.xensource.com/xen-users
2008 Jun 12
1
ADaCGH package crashes at mpiInit()
I have successfully installed ADaCGH package, and trying the example in SegmentPlotWrite did produce alot of pngs and html. I tried again the same example this morning (after a long night of installation), ADaCGH crashes at mpiInit() showing the error:
Loading required package: Rmpi
ELAN_EXCEPTION @ --: 6 (Initialisation error)
elan_init: Can't get capability from environment
Aborted
I
2008 Jun 23
2
grouping values
I tried aggregate, apply etc, but can't get the right result.
For example,
m <- cbind(c(LETTERS[1:5]), c("aa", "bb", "cc", "aa", "cc")) [,1] [,2][1,] "A" "aa"[2,] "B" "bb"[3,] "C" "cc"[4,] "D" "aa"[5,] "E" "cc"
how to obtain
2008 Jun 24
2
insert new columns to a matrix
Instead of prepend or append new columns to a matrix, how to insert them to a matrix ? For example, I would like to insert 3 new columns after the 5th column of matrix m.
_________________________________________________________________
[[elided Hotmail spam]]
[[alternative HTML version deleted]]
2008 Nov 04
2
Prevent read.table from converting "+" and "-" to 0
I am using read.table("data.txt", sep="\t") to read in a tab-limited text file. However, two columns of data were read wrongly. read.table converts "+" and "-" in the two columns to 0. I have tried setting other parameters but to no avail.
TIA
_________________________________________________________________
Get in touch with your inner athlete. Take the
2008 Jul 03
2
How to emulate perl style of reading files ?
I tried the following, obviously it didn't work. Hope you get my point, how to do it in R ? My objective is to read a large fasta file (but not storing the entire data into memory) , and compute some sequence composition statistics.
while(a <- readLines("test1") != EOF) print(a)
_________________________________________________________________
[[alternative HTML version
2008 Jul 25
2
How to preserve the numeric format and digits ?
Instead of
> m <- c(400000000, 50000000000)
> paste("A", m, "B", sep="")
[1] "A4e+08B" "A5e+10B"
I want "A400000000" and "A50000000000"