search for: daren

I have a folder full of pngs and jpgs, and would like to consolidate them into a pdf with appropriate title and labels. Can this be done via R ? _________________________________________________________________ Easily publish your photos to your Spaces with Photo Gallery. [[alternative HTML version deleted]]

For example, strings <- c("aaaa", "bbbb","ccba"). How to get "aaaa", "bbbb" that do not contain "ba" ? _________________________________________________________________ [[alternative HTML version deleted]]

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

For example, c("dog.is.an.animal", "cat.is.an.animal", "rat.is.an.animal"). How can I identify the common prefix is ".is.an.animal" and delete it to give c("dog", "cat", "rat") ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

I have a matrix containing -1, 0, 1, however certain rows will not have all 3 numbers. I have written some codes to compute the frequency table of how many -1s, 0s, 1s per row, but it is very ugly and not efficient if there are more than 3 numbers. Please suggest. m <- rbind(sample(0:1, replace=T, 10), sample(-1:1, replace=T, 10)) m.table <- t(apply(m, 1, function(x) c(sum(x==-1, na.rm=T),

Hi, How do I collapse (average in the simplest case) the values of those duplicated ids (i.e., 2, 5, 6, 9) to give a table of unique ids ? t <- cbind(id=c(1:10, 2,5,6,9), value=rnorm(14)) _________________________________________________________________ [[alternative HTML version deleted]]

unique(c(1:10,1)) gives 1:10 (i.e. unique values), is there any method to get only 2:10 (i.e. values that are unique) ? _________________________________________________________________ Easily edit your photos like a pro with Photo Gallery. [[alternative HTML version deleted]]

Hi, I have developed some scripts that basically ask for input tab-limited format files, do some processing, and output several pictures or csv. Now I need to have some gui to wrap on top of the scripts, so that end-users can select their input files, adjust some parameters for processing, and select output folder or filenames. Please advice me if there is any tools or project suitable for

I am generating a report containing several R scripts in the appendix. Is there any way to "beautify" the R source codes in microsoft word, similar to what we see in tinn-R ? Thanks _________________________________________________________________ [[alternative HTML version deleted]]

...o the point where it displays the uname info and then just stays there. It will not boot past that point. I have enabled VT technology in the BIOS (but only after the installation). Where/what can I look at to trouble shoot this? I am new to xen and would like to try and start trying it out. TIA, Daren This message posted from opensolaris.org

Hi, I am casting a dataframe from long to wide format. The same codes that works for a smaller dataframe would take a long time (more than two hours and still running) for a longer dataframe of 2495227 rows and ten different predictors. How to make it more efficient ? wer <- data.frame(Name=c(1:5, 4:5), Type=c(letters[1:5], letters[4:5]), Predictor=c("A", "A",

My two matrices are roughly the sizes of m1 and m2. I tried using two apply and cor.test to compute the correlation p.values. More than an hour, and the codes are still running. Please help to make it more efficient. m1 <- matrix(rnorm(100000), ncol=100) m2 <- matrix(rnorm(10000000), ncol=100) cor.pvalues <- apply(m1, 1, function(x) { apply(m2, 1, function(y) { cor.test(x,y)$p.value

i am currently not in singapore from the 6th to 10th Aug 2008. For anything urgent, please contact Daren at daren@hwzcorp.com Thanks. Best Regards, Choon Kiat _______________________________________________ Xen-users mailing list Xen-users@lists.xensource.com http://lists.xensource.com/xen-users

i am currently not in singapore from the 6th to 10th Aug 2008. For anything urgent, please contact Daren at daren@hwzcorp.com Thanks. Best Regards, Choon Kiat _______________________________________________ Xen-users mailing list Xen-users@lists.xensource.com http://lists.xensource.com/xen-users

I have successfully installed ADaCGH package, and trying the example in SegmentPlotWrite did produce alot of pngs and html. I tried again the same example this morning (after a long night of installation), ADaCGH crashes at mpiInit() showing the error: Loading required package: Rmpi ELAN_EXCEPTION @ --: 6 (Initialisation error) elan_init: Can't get capability from environment Aborted I

I tried aggregate, apply etc, but can't get the right result. For example, m <- cbind(c(LETTERS[1:5]), c("aa", "bb", "cc", "aa", "cc")) [,1] [,2][1,] "A" "aa"[2,] "B" "bb"[3,] "C" "cc"[4,] "D" "aa"[5,] "E" "cc" how to obtain

Instead of prepend or append new columns to a matrix, how to insert them to a matrix ? For example, I would like to insert 3 new columns after the 5th column of matrix m. _________________________________________________________________ [[elided Hotmail spam]] [[alternative HTML version deleted]]

I am using read.table("data.txt", sep="\t") to read in a tab-limited text file. However, two columns of data were read wrongly. read.table converts "+" and "-" in the two columns to 0. I have tried setting other parameters but to no avail. TIA _________________________________________________________________ Get in touch with your inner athlete. Take the

I tried the following, obviously it didn't work. Hope you get my point, how to do it in R ? My objective is to read a large fasta file (but not storing the entire data into memory) , and compute some sequence composition statistics. while(a <- readLines("test1") != EOF) print(a) _________________________________________________________________ [[alternative HTML version

Instead of > m <- c(400000000, 50000000000) > paste("A", m, "B", sep="") [1] "A4e+08B" "A5e+10B" I want "A400000000" and "A50000000000"