search for: cggtggtcagtctgggacctgggcagcaggct

Displaying 1 result from an estimated 1 matches for "cggtggtcagtctgggacctgggcagcaggct".

2008 Feb 23
2
counting sequence mismatches
Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA") seq2=c("AGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CAGTGGTCAGTCTGGGACCTGGGCATCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA") d.f=data.frame(seq1, seq2) thank you for your help Joseph ________________________________...