search for: cgcaatactaac

Displaying 1 result from an estimated 1 matches for "cgcaatactaac".

Did you mean: cgcaatactaacca
2010 Dec 21
3
Performing basic Multiple Sequence Alignment in R?
...we see the sequence that we will be able to observe. My goal is to reconstruct the left column using only the sequences I've got on the right column (based on the fact that many of the letters in each position are the same) Real_sequence The_sequence_we_see 1 CGCAATACTAAC-AGCTGACTTACGCACCG CGCAATACTAACAGCTGACTTACGCACCG 2 CGCAATACTAGC-AGGTGACTTCC-CT-CG CGCAATACTAGCAGGTGACTTCCCTCG 3 CGCAATGATCAC--GGTGGCTCCCGGTGCG CGCAATGATCACGGTGGCTCCCGGTGCG 4 CGCAATACTAACCA-CTAACT--CGCTGCG CGCAATACTAACCACTAACTCGCTGCG 5 CGCACGGGTAAGAACGTGA-TTACGCTCAG CGCACGGGTAAGAACGTGATT...