search for: celfiles

Displaying 20 results from an estimated 25 matches for "celfiles".

2020 Oct 21
4
how do I remove entries in data frame from a vector
..._BI_SNP_E09_35088 4 ABAFT_g_4RWG569_BI_SNP_E12_35136 5 ABAFT_g_4RWG569_BI_SNP_F11_35122 6 ABAFT_g_4RWG569_BI_SNP_F12_35138 7 ABAFT_g_4RWG569_BI_SNP_G07_35060 8 ABAFT_g_4RWG569_BI_SNP_G12_35140 I want to remove these 8 entries from remove data frame from this vector that looks like this: > head(celFiles) [1] "/GOKIND/75327/PhenoGenotypeFiles/RootStudyConsentSet_phs000018.GAIN_GoKinD.v2.p1.c1.DS-T1DCR-IRB/GenotypeFiles/ABAFT_g_4RWG569_BI_SNP_A01_34952.CEL" [2] "/GOKIND/75327/PhenoGenotypeFiles/RootStudyConsentSet_phs000018.GAIN_GoKinD.v2.p1.c1.DS-T1DCR-IRB/GenotypeFiles/ABAFT_g_4RWG...
2020 Oct 21
0
how do I remove entries in data frame from a vector
...2_35136 > 5 ABAFT_g_4RWG569_BI_SNP_F11_35122 > 6 ABAFT_g_4RWG569_BI_SNP_F12_35138 > 7 ABAFT_g_4RWG569_BI_SNP_G07_35060 > 8 ABAFT_g_4RWG569_BI_SNP_G12_35140 > > I want to remove these 8 entries from remove data frame from this > vector that looks like this: > > > head(celFiles) > > [1] > "/GOKIND/75327/PhenoGenotypeFiles/RootStudyConsentSet_phs000018.GAIN_GoKinD.v2.p1.c1.DS-T1DCR-IRB/GenotypeFiles/ABAFT_g_4RWG569_BI_SNP_A01_34952.CEL" > [2] > "/GOKIND/75327/PhenoGenotypeFiles/RootStudyConsentSet_phs000018.GAIN_GoKinD.v2.p1.c1.DS-T1DCR-IRB/G...
2011 Aug 08
1
read in cel file by ReadAffy and read.celfile
Hi there, I got a problem when trying to read in a .cel file using ReadAffy(). R codes: require(affy) ReadAffy(filenames="CH1.CEL") It failed and I got the error, Error in read.celfile.header(as.character(filenames[[1]])) : Is CH1.CEL really a CEL file? tried reading as text, gzipped text, binary, gzipped binary, command console and gzipped command console formats Also, I tried
2020 Oct 21
1
how do I remove entries in data frame from a vector
Hello, To remove the file extension it's much easier to use base R filename <- tools::file_path_sans_ext(basename(celFiles)) Hope this helps, Rui Barradas ?s 22:41 de 21/10/20, Rui Barradas escreveu: > Hello, > > This is probably because basename keeps the file extension, try instead > > > filename <- sub("(^[^\\.]*)\\..+$", "\\1", basename(celFiles)) > celFiles[!filen...
2020 Oct 21
0
how do I remove entries in data frame from a vector
Hello, This is probably because basename keeps the file extension, try instead filename <- sub("(^[^\\.]*)\\..+$", "\\1", basename(celFiles)) celFiles[!filename %in% as.character(remove$V1)] Hope this helps, Rui Barradas ?s 22:15 de 21/10/20, Ana Marija escreveu: > Hello, > > I have a data frame with one column: > >> remove > > V1 > > 1 ABAFT_g_4RWG569_BI_SNP_A10_35...
2012 Oct 07
1
BioConductor package: 'oligo'
...GTTTGCT > 341728 963863 AAACACGGTTATTCATCTGCGAAAC > 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA > 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA > > getwd() > [1] "C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi > cells/exData"} > > {library(oligo) > > celFiles<-list.celfiles("exData", full.names=TRUE) > > affyCit<-read.celfiles("GSM839728_GF_28mm_EC-1.CEL", > "GSM839729_GF_28mm_EC-2.CEL", "GSM839730_GF_28mm_EC-3.CEL", > "GSM839731_GF_28mm_PC-1.CEL", "GSM839732_GF_28mm_PC-2.CEL"...
2010 Mar 04
6
help
Hi all , I have one query. i have list of some .cel files. in my program i have to mention the path of these .cel files part of my program is, rna.data<-exprs(justRMA(filenames=file.names, celfile.path=*datadir*, sampleNames=sample.names, phenoData=pheno.data, cdfname=cleancdfname(hg18_Affymetrix U133A))) in the place of "datadir" i have to mention the character string of the
2018 Mar 21
1
Package 'pd.mirna.1.0.2xgain' was not found in the BioConductor repository
Hi all! While I am trying to read .cel files with oligo package: afbatch=read.celfiles(list.celfiles()) I get an error: Package 'pd.mirna.1.0.2xgain' was not found in the BioConductor repository How can I overcome this? Thank you in advance
2009 Dec 26
1
[BioC] How to do RMA without summary to probeset level?
...wrote: > pm(data) > > b > > On Dec 26, 2009, at 2:21 PM, Peng Yu wrote: > >> I use the following code to do RMA. I'm wondering how get the probe >> level values before the summary to the probeset level values. >> >> library(oligo) >> data<-read.celfiles(list.celfiles(data_dir, full.names=TRUE)) >> eset<-rma(data) >> write.exprs(eset, file='output_file_name', sep="\t") >> >> _______________________________________________ >> Bioconductor mailing list >> Bioconductor at stat.math.ethz.ch >&...
2009 Aug 25
1
package dependencies specification
Hello, After running R CMD check on my package I received the following error on package dependencies: * using log directory 'C:/z-zBackup/Nuvera Bio on Iatros01/Development/RPackages/nvNormalize/nvNormalize.Rcheck' * using R version 2.9.1 (2009-06-26) * using session charset: ISO8859-1 * checking for file 'nvNormalize/DESCRIPTION' ... OK * checking extension type ... Package *
2018 May 02
7
download.file does not process gz files correctly (truncates them?)
Dear all, I've noticed by trying to download gz files from here : https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907811 At the bottom one can download GSM907811.CEL.gz . If I download this manually and try oligo::read.celfiles("GSM907811.CEL.gz") everything works fine. (oligo is a bioConductor package) However, if I download using download.file(" https://www.ncbi.nlm.nih.gov/geo/download/?acc=GSM907811&format=file&file=GSM907811%2ECEL%2Egz ", destfile = "GSM907811.CEL.gz&...
2007 Aug 06
1
Problems with expresso
Hello, I want to use expresso for preprocessing the hgu133a-spikein data from affycompII. But there is an error: > library(affy) > path <- "z:/Microarray/hgu133a-spikein/rawdata" > celFile <- list.celfiles(path=path,full.names=TRUE); > affyBatch <- ReadAffy(filenames=celFile[1:6]); > eset1 <- expresso(affyBatch,bgcorrect.method="rma",normalize.method="quantiles",summary.method="medianpolish") background correction: rma normalization: quantiles PM/MM corre...
2005 Aug 31
1
tcl/tk return problem
Hello, I'm very new in working with tcl/tk in R and have a problem which will probably sound silly to most of you. Here is the code I have problems with: readcelfiles <- function() { require(tcltk) tt <- tktoplevel() tkgrid(tklabel(tt,text="Choose a directory!")) OnOK <- function() { fileDir<-tclvalue(tkchooseDirectory()) data.raw <- ReadAffy(celfile.path=fileDir) #return(data.raw) } OK.but <- tkbutton(tt,...
2018 May 03
0
download.file does not process gz files correctly (truncates them?)
...PM, Joris Meys wrote: > Dear all, > > I've noticed by trying to download gz files from here : > https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907811 > > At the bottom one can download GSM907811.CEL.gz . If I download this > manually and try > > oligo::read.celfiles("GSM907811.CEL.gz") > > everything works fine. (oligo is a bioConductor package) > > However, if I download using > > download.file(" > https://www.ncbi.nlm.nih.gov/geo/download/?acc=GSM907811&format=file&file=GSM907811%2ECEL%2Egz > ", >...
2009 Jan 27
1
Problem with RMA using limma, oligo and pdInfoBuilder packages
...go) > library(limma) > library(genefilter) Loading required package: survival > library(geneplotter) Loading required package: lattice Loading required package: annotate Loading required package: xtable KernSmooth 2.22 installed Copyright M. P. Wand 1997 > cel.files <- list.celfiles(".", full.names = TRUE) > basename(cel.files) [1] "AD_Ctrl_1.CEL" "AD_Ctrl_2.CEL" "AD_Ctrl_3.CEL" "AD_Ctrl_5.CEL" [5] "AD_Ctrl_6.CEL" "AD_Traite_10.CEL" "AD_Traite_11.CEL" "AD_Traite_7.CEL"...
2012 Feb 28
1
Error in read.table(file = file, header = header, sep = sep, quote = quote, : more columns than column names
Hey, I just googled my error and many things came up. I followed the leads and read the ?read.delim page; I tried changing header = TRUE, and row.names = TRUE-- but I've still been having trouble fixing it, so I would greatly appreciate any help you can provide. Here is my code: rm(list=ls()) source("../../functions.R") uncurated <-
2018 May 03
0
download.file does not process gz files correctly (truncates them?)
...at gmail.com> wrote: > Dear all, > > I've noticed by trying to download gz files from here : > https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907811 > > At the bottom one can download GSM907811.CEL.gz . If I download this > manually and try > > oligo::read.celfiles("GSM907811.CEL.gz") > > everything works fine. (oligo is a bioConductor package) > > However, if I download using > > download.file(" > > https://www.ncbi.nlm.nih.gov/geo/download/?acc=GSM907811&format=file&file=GSM907811%2ECEL%2Egz > ", >...
2011 May 09
1
rquest for help
Sir, Kindlly Guide me how to get the R CELFILES. I have install R but I cannat asses the command: Data <- ReadAffy() and I got the error: Error in AllButCelsForReadAffy(..., filenames = filenames, widget = widget, : No cel filennames specified and no cel files in specified directory:C:/Documents and Settings/pawan.k/Desktop. Wit regds, P...
2018 May 03
0
download.file does not process gz files correctly (truncates them?)
...ear all, >> >> I've noticed by trying to download gz files from here : >> https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907811 >> >> At the bottom one can download GSM907811.CEL.gz . If I download this >> manually and try >> >> oligo::read.celfiles("GSM907811.CEL.gz") >> >> everything works fine. (oligo is a bioConductor package) >> >> However, if I download using >> >> download.file(" >> https://www.ncbi.nlm.nih.gov/geo/download/?acc=GSM907811&for >> mat=file&file=GSM9078...
2018 May 03
0
download.file does not process gz files correctly (truncates them?)
...at gmail.com> wrote: > Dear all, > > I've noticed by trying to download gz files from here : > https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM907811 > > At the bottom one can download GSM907811.CEL.gz . If I download this > manually and try > > oligo::read.celfiles("GSM907811.CEL.gz") > > everything works fine. (oligo is a bioConductor package) > > However, if I download using > > download.file("https://www.ncbi.nlm.nih.gov/geo/download/ > ?acc=GSM907811&format=file&file=GSM907811%2ECEL%2Egz", >...