search for: cel

Hi all, I have a total newbie question, but I could really use some help. I need to read in this file: SampleID Disease E-CBIL-28-raw-cel-1435145228.cel 1 E-CBIL-28-raw-cel-1435145451.cel 2 E-CBIL-28-raw-cel-1435145479.cel 2 E-CBIL-28-raw-cel-1435145132.cel 3 E-CBIL-28-raw-cel-1435145417.cel 3 E-CBIL-28-raw-cel-1435145301.cel 2 E-CBIL-28-raw-cel-1435145558.cel 1 E-CBIL-28-raw-cel-1435145073.cel 3 E-CBIL-28-raw-cel-1435145196...

Hi, On Asterisk 16.11.1 when enabling cel I get error with BRIDGE_START and BRIDGE_END events zone-s*CLI> module reload cel The module 'cel' reported a reload failure     -- Reloading module 'cel' (CEL Engine) [2020-07-10 17:57:01] ERROR[16163]: cel.c:428 ast_cel_str_to_event_type: Unknown event name 'BRIDGE_STAR...

Hi, R 2.5.0 isn't auto-completing paths properly as it used to. E.g. suppose I have: > dir("CEL/choe") [1] "chipC-rep1.CEL" "chipC-rep2.CEL" "chipC-rep3.CEL" "chipS-rep1.CEL" [5] "chipS-rep2.CEL" "chipS-rep3.CEL" Now if I do: ReadAffy("CEL/choe/ch<tab> # => ReadAffy("CEL/choe/chip ReadAffy("CEL/choe/chi...

Hi, Is there any function to replace colProds that finds column-wise products of a matrix? Or is there any other function that would give a better solution this problem ? I have a matrix and an array, example: > a GSM1.CEL GSM2.CEL GSM1.CEL 10000_at 1 3 1 10001_at 3 3 3 > b 10000_at 10001_at 1 3 I want to find the number of occurrences of this array within the matrix (which in this case is 2). > a==b gives me:...

...t. The columns are the samples and the rows are the probes. I binded the first line, called "norm", which represents the estimated output. I want to create a linear model which shows the relationship between the gene expressions (rows) and the output (norm). *data* GSM276723.CEL GSM276724.CEL GSM276725.CEL GSM276726.CEL norm 0.897000 0.590000 0.683000 0.949000 206427_s_at 5.387205 6.036506 8.824783 10.864122 205338_s_at 6.454779 13.143095 6.123212 12.726562 209848_s_at 6.703062 7.783330 12.175654...

On Wed, Jul 22, 2020 at 12:44 PM Administrator <admin at tootai.net> wrote: > No one on this ? > > Le 10/07/2020 à 18:06, Administrator a écrit : > > Hi, > > > > On Asterisk 16.11.1 when enabling cel I get error with BRIDGE_START > > and BRIDGE_END events > > > > zone-s*CLI> module reload cel > > The module 'cel' reported a reload failure > > -- Reloading module 'cel' (CEL Engine) > > [2020-07-10 17:57:01] ERROR[16163]: cel.c:428 > &...

Dear list, I need to read a big txt file (around 130Mb; 23800 rows and 49 columns) for downstream clustering analysis. I first used "Tumor <- read.table("Tumor.txt",header = TRUE,sep = "\t")" but it took a long time and failed. However, it had no problem if I just put data of 3 columns. Is there any way which can load this big file? Thanks for any suggestions!

...TGTTCAGAGGGCCCTACA > 341727 963859 GGTGCAGTTCGACTCTAAGTTTGCT > 341728 963863 AAACACGGTTATTCATCTGCGAAAC > 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA > 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA > > getwd() > [1] "C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi > cells/exData"} > > {library(oligo) > > celFiles<-list.celfiles("exData", full.names=TRUE) > > affyCit<-read.celfiles("GSM839728_GF_28mm_EC-1.CEL", > "GSM839729_GF_28mm_EC-2.CEL", "GSM839730_GF_28mm_EC-3.CEL", > "GSM839731_G...

...bioinformatics.picr.man.ac.uk/simpleaffy mailto: microarray at picr.man.ac.uk Background correcting Retrieving data from AffyBatch...done. Computing expression calls... .........................done. scaling to a TGT of 100 ... Scale factor for: 0203_YH10_H_MCF7_r1.CEL 0.291660289301555 Scale factor for: 0203_YH11_H_MCF10A_r1.CEL 0.42025300545212 Scale factor for: 0203_YH12_H_a100MCF7_r1.CEL 0.287589038746987 Scale factor for: 0203_YH13_H_a100MCF10A_r1.CEL 0.451200408584071 Scale factor for: 0203_YH14_H_a10MCF7_r1.CEL 0.385462078301135 Scale factor for: 0203_YH15...

No one on this ? Le 10/07/2020 à 18:06, Administrator a écrit : > Hi, > > On Asterisk 16.11.1 when enabling cel I get error with BRIDGE_START > and BRIDGE_END events > > zone-s*CLI> module reload cel > The module 'cel' reported a reload failure >     -- Reloading module 'cel' (CEL Engine) > [2020-07-10 17:57:01] ERROR[16163]: cel.c:428 > ast_cel_str_to_event_type: Un...

...user is a member of. I can read and write to the share, but sometimes I lose data. I can't figure out any pattern. Just now, I downloaded a 2.4GB TAR file. It worked perfectly. Then I go to extract the TAR, and about 25% of them are zero bytes. $ du -hsc * 2.4G GSE14333_RAW.tar 0 GSM358341.CEL.gz 8.9M GSM358342.CEL.gz 9.0M GSM358343.CEL.gz 8.6M GSM358344.CEL.gz 0 GSM358345.CEL.gz 0 GSM358346.CEL.gz 8.7M GSM358347.CEL.gz 8.9M GSM358348.CEL.gz 0 GSM358349.CEL.gz 8.4M GSM358350.CEL.gz 8.7M GSM358351.CEL.gz All these files should be 7-9M in size. TAR did not complain at all when I untarre...

..._BI_SNP_E09_35088 4 ABAFT_g_4RWG569_BI_SNP_E12_35136 5 ABAFT_g_4RWG569_BI_SNP_F11_35122 6 ABAFT_g_4RWG569_BI_SNP_F12_35138 7 ABAFT_g_4RWG569_BI_SNP_G07_35060 8 ABAFT_g_4RWG569_BI_SNP_G12_35140 I want to remove these 8 entries from remove data frame from this vector that looks like this: > head(celFiles) [1] "/GOKIND/75327/PhenoGenotypeFiles/RootStudyConsentSet_phs000018.GAIN_GoKinD.v2.p1.c1.DS-T1DCR-IRB/GenotypeFiles/ABAFT_g_4RWG569_BI_SNP_A01_34952.CEL" [2] "/GOKIND/75327/PhenoGenotypeFiles/RootStudyConsentSet_phs000018.GAIN_GoKinD.v2.p1.c1.DS-T1DCR-IRB/GenotypeFiles/ABAFT_g...

Hi all , I have one query. i have list of some .cel files. in my program i have to mention the path of these .cel files part of my program is, rna.data<-exprs(justRMA(filenames=file.names, celfile.path=*datadir*, sampleNames=sample.names, phenoData=pheno.data, cdfname=cleancdfname(hg18_Affymetrix U133A))) in the place of "datadir" i...

...lists of matrices. Each list has 6 matrices - Each matrix is 20x10. I need to do some basic math on corresponding matrices in each list. Here are some outputs of these lists, etc... # first list > length(qc.pm) [1] 6 > dim(qc.pm[[1]]) [1] 20 10 > qc.pm[[1]][1:4,1:4] 441-JP071707.CEL 442-JP071707.CEL 443-JP071707.CEL 444-JP071707.CEL 495086 11923 9209 7980 10088 31276 6883 5577 3985 5561 6479 4730 3700 2170 4772 673616 9495 8015 5252...

Hi there, I got a problem when trying to read in a .cel file using ReadAffy(). R codes: require(affy) ReadAffy(filenames="CH1.CEL") It failed and I got the error, Error in read.celfile.header(as.character(filenames[[1]])) : Is CH1.CEL really a CEL file? tried reading as text, gzipped text, binary, gzipped binary, command console and gzip...

...t;) > library(oligo) > library(limma) > library(genefilter) Loading required package: survival > library(geneplotter) Loading required package: lattice Loading required package: annotate Loading required package: xtable KernSmooth 2.22 installed Copyright M. P. Wand 1997 > cel.files <- list.celfiles(".", full.names = TRUE) > basename(cel.files) [1] "AD_Ctrl_1.CEL" "AD_Ctrl_2.CEL" "AD_Ctrl_3.CEL" "AD_Ctrl_5.CEL" [5] "AD_Ctrl_6.CEL" "AD_Traite_10.CEL" "AD_Traite_11.CEL" &...

Hi!I'm doing a little data importing from .cel files, > setwd("/home/mandova/celfiles") > mydata<-ReadAffy() Error in sub("^/?([^/]*/)*", "", filenames, extended = TRUE) : unused argument(s) (extended = TRUE) Then I tried > filenames<-paste("GSM",c(seq(138597,138617,1)),".cel&q...

Hi, I am using Asterisk 11.2.0. Channel Event Logging (CEL) ist activated and running. CEL entries are logged into an mysql database. So far so good. I want to do some extra cel logging and try the following via an AGI-Script: EXEC CELGenUserEvent test In the asterisk logfile I can see the following: -- AGI Script Executing Application: (CELGenUserEvent...

...2_35136 > 5 ABAFT_g_4RWG569_BI_SNP_F11_35122 > 6 ABAFT_g_4RWG569_BI_SNP_F12_35138 > 7 ABAFT_g_4RWG569_BI_SNP_G07_35060 > 8 ABAFT_g_4RWG569_BI_SNP_G12_35140 > > I want to remove these 8 entries from remove data frame from this > vector that looks like this: > > > head(celFiles) > > [1] > "/GOKIND/75327/PhenoGenotypeFiles/RootStudyConsentSet_phs000018.GAIN_GoKinD.v2.p1.c1.DS-T1DCR-IRB/GenotypeFiles/ABAFT_g_4RWG569_BI_SNP_A01_34952.CEL" > [2] > "/GOKIND/75327/PhenoGenotypeFiles/RootStudyConsentSet_phs000018.GAIN_GoKinD.v2.p1.c1.DS-T1DCR-...

...ot;15", "16", "17", "18", "19", "20", "21", "22", "23", "24", "25", "26", "27", "28", "29", "30"), c("probeset_id", "AFGEX1209.10.CEL", "AFGEX1209.11.CEL", "AFGEX1209.12_2.CEL", "AFGEX1209.13.CEL", "AFGEX1209.14.CEL", "AFGEX1209.15.CEL", "AFGEX1209.16.CEL", "AFGEX1209.17.CEL", "AFGEX1209.18.CEL", "AFGEX1209.19.CEL", "AFGEX1209.21.C...