Displaying 20 results from an estimated 1045 matches for "cel".
Did you mean:
celt
2010 Oct 26
3
Reading in a tab delimitated file
Hi all,
I have a total newbie question, but I could really use some help.
I need to read in this file:
SampleID Disease
E-CBIL-28-raw-cel-1435145228.cel 1
E-CBIL-28-raw-cel-1435145451.cel 2
E-CBIL-28-raw-cel-1435145479.cel 2
E-CBIL-28-raw-cel-1435145132.cel 3
E-CBIL-28-raw-cel-1435145417.cel 3
E-CBIL-28-raw-cel-1435145301.cel 2
E-CBIL-28-raw-cel-1435145558.cel 1
E-CBIL-28-raw-cel-1435145073.cel 3
E-CBIL-28-raw-cel-1435145196...
2020 Jul 10
2
module cel error with bridge events
Hi,
On Asterisk 16.11.1 when enabling cel I get error with BRIDGE_START and
BRIDGE_END events
zone-s*CLI> module reload cel
The module 'cel' reported a reload failure
-- Reloading module 'cel' (CEL Engine)
[2020-07-10 17:57:01] ERROR[16163]: cel.c:428 ast_cel_str_to_event_type:
Unknown event name 'BRIDGE_STAR...
2007 Apr 26
2
path autocompletion in 2.5.0
Hi,
R 2.5.0 isn't auto-completing paths properly as it used to. E.g.
suppose I have:
> dir("CEL/choe")
[1] "chipC-rep1.CEL" "chipC-rep2.CEL" "chipC-rep3.CEL" "chipS-rep1.CEL"
[5] "chipS-rep2.CEL" "chipS-rep3.CEL"
Now if I do:
ReadAffy("CEL/choe/ch<tab> # => ReadAffy("CEL/choe/chip
ReadAffy("CEL/choe/chi...
2010 Aug 15
3
Rows index/colProds
Hi,
Is there any function to replace colProds that finds column-wise products of
a matrix?
Or is there any other function that would give a better solution this
problem ?
I have a matrix and an array, example:
> a
GSM1.CEL GSM2.CEL GSM1.CEL
10000_at 1 3 1
10001_at 3 3 3
> b
10000_at 10001_at
1 3
I want to find the number of occurrences of this array within the matrix
(which in this case is 2).
> a==b
gives me:...
2009 Oct 26
2
help with linear model
...t. The columns are the samples and the rows are the
probes. I binded the first line, called "norm", which represents the
estimated output. I want to create a linear model which shows the
relationship between the gene expressions (rows) and the output (norm).
*data*
GSM276723.CEL GSM276724.CEL GSM276725.CEL GSM276726.CEL
norm 0.897000 0.590000 0.683000 0.949000
206427_s_at 5.387205 6.036506 8.824783 10.864122
205338_s_at 6.454779 13.143095 6.123212 12.726562
209848_s_at 6.703062 7.783330 12.175654...
2020 Jul 22
1
module cel error with bridge events
On Wed, Jul 22, 2020 at 12:44 PM Administrator <admin at tootai.net> wrote:
> No one on this ?
>
> Le 10/07/2020 à 18:06, Administrator a écrit :
> > Hi,
> >
> > On Asterisk 16.11.1 when enabling cel I get error with BRIDGE_START
> > and BRIDGE_END events
> >
> > zone-s*CLI> module reload cel
> > The module 'cel' reported a reload failure
> > -- Reloading module 'cel' (CEL Engine)
> > [2020-07-10 17:57:01] ERROR[16163]: cel.c:428
> &...
2007 Jun 07
3
How to load a big txt file
Dear list,
I need to read a big txt file (around 130Mb; 23800 rows and 49 columns)
for downstream clustering analysis.
I first used "Tumor <- read.table("Tumor.txt",header = TRUE,sep = "\t")"
but it took a long time and failed. However, it had no problem if I just put
data of 3 columns.
Is there any way which can load this big file?
Thanks for any suggestions!
2012 Oct 07
1
BioConductor package: 'oligo'
...TGTTCAGAGGGCCCTACA
> 341727 963859 GGTGCAGTTCGACTCTAAGTTTGCT
> 341728 963863 AAACACGGTTATTCATCTGCGAAAC
> 341729 963874 GATGCTCTTCATTGGGAGGCAGCGA
> 341730 963889 ATTGATACAGCCTTCTCTGCAGTAA
> > getwd()
> [1] "C:/Users/franklin.johnson.PW50-WEN/Desktop/GSE33964_citrus epi
> cells/exData"}
>
> {library(oligo)
> > celFiles<-list.celfiles("exData", full.names=TRUE)
> > affyCit<-read.celfiles("GSM839728_GF_28mm_EC-1.CEL",
> "GSM839729_GF_28mm_EC-2.CEL", "GSM839730_GF_28mm_EC-3.CEL",
> "GSM839731_G...
2005 Aug 31
1
Bioconductor and R-devel
...bioinformatics.picr.man.ac.uk/simpleaffy
mailto: microarray at picr.man.ac.uk
Background correcting
Retrieving data from AffyBatch...done.
Computing expression calls...
.........................done.
scaling to a TGT of 100 ...
Scale factor for: 0203_YH10_H_MCF7_r1.CEL 0.291660289301555
Scale factor for: 0203_YH11_H_MCF10A_r1.CEL 0.42025300545212
Scale factor for: 0203_YH12_H_a100MCF7_r1.CEL 0.287589038746987
Scale factor for: 0203_YH13_H_a100MCF10A_r1.CEL 0.451200408584071
Scale factor for: 0203_YH14_H_a10MCF7_r1.CEL 0.385462078301135
Scale factor for: 0203_YH15...
2020 Jul 22
0
module cel error with bridge events
No one on this ?
Le 10/07/2020 à 18:06, Administrator a écrit :
> Hi,
>
> On Asterisk 16.11.1 when enabling cel I get error with BRIDGE_START
> and BRIDGE_END events
>
> zone-s*CLI> module reload cel
> The module 'cel' reported a reload failure
> -- Reloading module 'cel' (CEL Engine)
> [2020-07-10 17:57:01] ERROR[16163]: cel.c:428
> ast_cel_str_to_event_type: Un...
2012 Mar 06
1
zero byte files
...user is a member of.
I can read and write to the share, but sometimes I
lose data. I can't figure out any pattern.
Just now, I downloaded a 2.4GB TAR file. It worked
perfectly. Then I go to extract the TAR, and about
25% of them are zero bytes.
$ du -hsc *
2.4G GSE14333_RAW.tar
0 GSM358341.CEL.gz
8.9M GSM358342.CEL.gz
9.0M GSM358343.CEL.gz
8.6M GSM358344.CEL.gz
0 GSM358345.CEL.gz
0 GSM358346.CEL.gz
8.7M GSM358347.CEL.gz
8.9M GSM358348.CEL.gz
0 GSM358349.CEL.gz
8.4M GSM358350.CEL.gz
8.7M GSM358351.CEL.gz
All these files should be 7-9M in size. TAR did not complain
at all when I untarre...
2020 Oct 21
4
how do I remove entries in data frame from a vector
..._BI_SNP_E09_35088
4 ABAFT_g_4RWG569_BI_SNP_E12_35136
5 ABAFT_g_4RWG569_BI_SNP_F11_35122
6 ABAFT_g_4RWG569_BI_SNP_F12_35138
7 ABAFT_g_4RWG569_BI_SNP_G07_35060
8 ABAFT_g_4RWG569_BI_SNP_G12_35140
I want to remove these 8 entries from remove data frame from this
vector that looks like this:
> head(celFiles)
[1] "/GOKIND/75327/PhenoGenotypeFiles/RootStudyConsentSet_phs000018.GAIN_GoKinD.v2.p1.c1.DS-T1DCR-IRB/GenotypeFiles/ABAFT_g_4RWG569_BI_SNP_A01_34952.CEL"
[2] "/GOKIND/75327/PhenoGenotypeFiles/RootStudyConsentSet_phs000018.GAIN_GoKinD.v2.p1.c1.DS-T1DCR-IRB/GenotypeFiles/ABAFT_g...
2010 Mar 04
6
help
Hi all ,
I have one query.
i have list of some .cel files. in my program i have to mention the path of
these .cel files
part of my program is,
rna.data<-exprs(justRMA(filenames=file.names, celfile.path=*datadir*,
sampleNames=sample.names, phenoData=pheno.data,
cdfname=cleancdfname(hg18_Affymetrix U133A)))
in the place of "datadir" i...
2007 Oct 09
1
Handling two lists of matrices
...lists of
matrices. Each list has 6 matrices - Each matrix is 20x10. I need to
do some basic math on corresponding matrices in each list.
Here are some outputs of these lists, etc...
# first list
> length(qc.pm)
[1] 6
> dim(qc.pm[[1]])
[1] 20 10
> qc.pm[[1]][1:4,1:4]
441-JP071707.CEL 442-JP071707.CEL 443-JP071707.CEL
444-JP071707.CEL
495086 11923 9209 7980
10088
31276 6883 5577 3985
5561
6479 4730 3700 2170
4772
673616 9495 8015 5252...
2011 Aug 08
1
read in cel file by ReadAffy and read.celfile
Hi there,
I got a problem when trying to read in a .cel file using ReadAffy().
R codes:
require(affy)
ReadAffy(filenames="CH1.CEL")
It failed and I got the error,
Error in read.celfile.header(as.character(filenames[[1]])) :
Is CH1.CEL really a CEL file? tried reading as text, gzipped text, binary,
gzipped binary, command console and gzip...
2009 Jan 27
1
Problem with RMA using limma, oligo and pdInfoBuilder packages
...t;)
> library(oligo)
> library(limma)
> library(genefilter)
Loading required package: survival
> library(geneplotter)
Loading required package: lattice
Loading required package: annotate
Loading required package: xtable
KernSmooth 2.22 installed
Copyright M. P. Wand 1997
> cel.files <- list.celfiles(".", full.names = TRUE)
> basename(cel.files)
[1] "AD_Ctrl_1.CEL" "AD_Ctrl_2.CEL" "AD_Ctrl_3.CEL"
"AD_Ctrl_5.CEL"
[5] "AD_Ctrl_6.CEL" "AD_Traite_10.CEL" "AD_Traite_11.CEL"
&...
2010 Aug 04
1
error with ReadAffy()
Hi!I'm doing a little data importing from .cel files,
> setwd("/home/mandova/celfiles")
> mydata<-ReadAffy()
Error in sub("^/?([^/]*/)*", "", filenames, extended = TRUE) :
unused argument(s) (extended = TRUE)
Then I tried
> filenames<-paste("GSM",c(seq(138597,138617,1)),".cel&q...
2013 Jan 25
0
CEL / CELGenUserEvent via AGI / no error and no cel entry
Hi,
I am using Asterisk 11.2.0. Channel Event Logging (CEL) ist activated
and running. CEL entries are logged into an mysql database. So far so good.
I want to do some extra cel logging and try the following via an AGI-Script:
EXEC CELGenUserEvent test
In the asterisk logfile I can see the following:
-- AGI Script Executing Application: (CELGenUserEvent...
2020 Oct 21
0
how do I remove entries in data frame from a vector
...2_35136
> 5 ABAFT_g_4RWG569_BI_SNP_F11_35122
> 6 ABAFT_g_4RWG569_BI_SNP_F12_35138
> 7 ABAFT_g_4RWG569_BI_SNP_G07_35060
> 8 ABAFT_g_4RWG569_BI_SNP_G12_35140
>
> I want to remove these 8 entries from remove data frame from this
> vector that looks like this:
>
> > head(celFiles)
>
> [1]
> "/GOKIND/75327/PhenoGenotypeFiles/RootStudyConsentSet_phs000018.GAIN_GoKinD.v2.p1.c1.DS-T1DCR-IRB/GenotypeFiles/ABAFT_g_4RWG569_BI_SNP_A01_34952.CEL"
> [2]
> "/GOKIND/75327/PhenoGenotypeFiles/RootStudyConsentSet_phs000018.GAIN_GoKinD.v2.p1.c1.DS-T1DCR-...
2012 Dec 07
1
Help with manipulation of matrix object
...ot;15",
"16", "17", "18", "19", "20", "21", "22", "23", "24", "25", "26",
"27", "28", "29", "30"), c("probeset_id", "AFGEX1209.10.CEL",
"AFGEX1209.11.CEL", "AFGEX1209.12_2.CEL", "AFGEX1209.13.CEL",
"AFGEX1209.14.CEL", "AFGEX1209.15.CEL", "AFGEX1209.16.CEL",
"AFGEX1209.17.CEL",
"AFGEX1209.18.CEL", "AFGEX1209.19.CEL", "AFGEX1209.21.C...