search for: caa

Dear all, I wrote the following batch script on a iMac, and ran it on a linux mosix cluster. tu <- read.table("cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshape.table") tu_reshaped <- t(reshape(tu[1:50,], direction="wide", timevar="tu", idvar=c("rna","lib"))) write.table(tu_reshaped, "cage.mm5.tags.rna_lib.CAA-CAJ.tu-reshaped.table") q(sav="no") (I will remove the [1:50,] l...

Hello, I am having a some problems getting SSHD to run on the Ipv6 interface. Interface/Ipv6 Address: ipv6.open-systems.org [kevin at satan kevin/xp-0.0.15] 536 $ping6 ipv6.open-systems.org PING6(56=40+8+8 bytes) 3ffe:1200:3028:ff01::cab --> 3ffe:1200:3028:ff01::caa 16 bytes from 3ffe:1200:3028:ff01::caa, icmp_seq=0 hlim=64 time=73.96 ms sshd_config: ListenAddress [3ffe:1200:3028:ff01::caa] ListenAddress [3ffe:1200:3028:8655::1] [Note: I also tried using the address's without the brackets with no results.] sshd version : sshd version OpenSSH_2.9 ssh...

PowerDNS supports CAA records beginning with version 4.0, but the pdns package in EPEL for most recent centos versions is stuck at around version 3.4 (3.4.11 is what I have). Do I have no other choice but to manually compile and maintain my own pdns installation? I prefer to avoid this but I need up-to-date feature...

--On Friday, December 08, 2017 7:54 PM +0000 MRob <mrobti at insiberia.net> wrote: > PowerDNS supports CAA records beginning with version 4.0, but the pdns > package in EPEL for most recent centos versions is stuck at around > version 3.4 (3.4.11 is what I have). > > Do I have no other choice but to manually compile and maintain my own > pdns installation? I prefer to avoid this but I nee...

...able>(VV); Value *VVV = cast<Value>(FD->getOperand(0)); errs()<<"\n VVV "<<*(VVV)<<"\n"; RESULT : VVV [3 x i8] c"DS\00" if(VVV->getValueID() == Value::ConstantDataArrayVal){ ConstantArray *caa = (ConstantArray *)VVV; errs()<<"\n "<<(caa->getNumOperands())<<"\n"; errs()<<"\n "<<*(caa->getType())<<"\n"; RESULT : 0 [3 x i8] } >From this po...

...calcMin I get an error regarding unused arguments. No partial matches to previous arguments that I can see. Anybody know the reason or fix for this? calcMin(pvec=data.frame(val=par,min=rep(.000001,length(par)),max=rep(100 0000,length(par)),active=rep(TRUE,length(par))),func=optimwrap2, resid=resid,caa=caa,na=na,vcode=vcode,maa=maa,ny=ny,nind=nind,qage=qage, selmod=selmod,oldagei=oldagei,vpaflag=vpaflag) Error in f(x, ...) : unused argument(s) (resid = c(0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,...

Hi all, I have experience using puppet, however I am new to setting puppet up as it was already done for me in past environments. I am running into an issue while trying to set puppet up for the first time on RHEL 6.4. I was hoping y''all might be able to help me! I get the following error from the puppet client''s /var/log/messages log: May 30 07:06:30 pclient

On Sat, May 27, 2023 at 02:45:34AM +0200, Thorsten Glaser <t.glaser at tarent.de> wrote: > On Sat, 27 May 2023, raf wrote: > > >So, perhaps this could be added to the existing > >sentence/paragraph: > > > > "so any spaces in individual arguments must be > > Must they? No, a single space will do just fine. They do if you want the receiving shell

Hi, Is this method broken in R? I am using it to find roots of the following function: f(x) = 2.5*exp(-0.5*(2*0.045 - x)) + 2.5*exp(-0.045) + 2.5*exp(-1.5*x) - 100 It is giving an answer of -38.4762403 which is not even close (f(x) = 2.903809e+25 for x=-38.4762403). The answer should be around 0.01-0.1. This function should converge.. Even for a simple function like f(x) = exp(-x) * x, it gives

...1208 170 157 68 495 922 NAA 60 110 10 7 44 51 94 DAA 183 802 41 62 26 166 263 CAA 58 12 58 1 1 23 8 TAA 451 468 201 90 131 320 518 For certain specific columns, I need to merge the columns in such a way that the elements...

...and I now have that part figured out! Best Wishes, Dan Frauke Message: 3 Date: Mon, 12 Oct 2020 08:33:44 +0200 (CEST) From: =?UTF-8?Q?Frauke_G=C3=BCnther?= <guenther at leibniz-bips.de> To: "r-help at r-project.org" <r-help at r-project.org> Cc: William Michels <wjm1 at caa.columbia.edu>, "smm at posteo.org" <smm at posteo.org> Subject: Re: [R] Fwd: Help using the exclude option in the neuralnet package Message-ID: <957726669.124476.1602484424752 at srvmail.bips.eu> Content-Type: text/plain; charset="utf-8" Dear al...

...ering works > perfectly. I wrote a detailed blog article about it. > > https://blog.microlinux.fr/squid-https-centos/ I wonder if this works with all https enabled sites? Chrome has capabilities hardcoded to check google certificates. Certificate Transparency, HTTP Public Key Pinning, CAA DNS are also supporting the end node to identify MITM. I hope that such setup will be unpractical in the near future. About your legal requirements; Weighing is what courts daily do. So, such requirements are not asking you to destroy the integrity and confidentiality >95% of users activ...

...x(c(1,2,1, 2,2,1),byrow=T, nrow=2), constant.weights=c(100,1000)) > nn$weights [[1]] [[1]][[1]] [,1] [1,] 0.554119 [2,] 100.000000 [3,] 1.153611 [[1]][[2]] [,1] [1,] -0.3962524 [2,] 1000.0000000 I hope you will find this example helpful. Sincerely, Frauke > William Michels <wjm1 at caa.columbia.edu mailto:wjm1 at caa.columbia.edu > hat am 10.10.2020 18:16 geschrieben: > > > Forwarding: Question re "neuralnet" package on the R-Help mailing list: > > https://stat.ethz.ch/pipermail/r-help/2020-October/469020.html > >...

The new messages are written in ------------------> ------------------- caas it wrote: | I am using samba-3.0.7 on kernel version 2.6.5-3 | (client as well as server). | I traced the exact function calling sequence when a | "mkdir" command is given at the client side. | I got stuck at the server side, | | source/smbd/vfs.c - vfs_MkDir() - | SMB_VFS_MKDIR(conn,na...

...implest case. for example, if i have a string read in: > newdata5 $testseq [1] "agtgagatgatagatagatagatagatagatagatagaccccccagata" and then i perform an RSCU analysis on it... > uco(newdata5,index="rscu") aaa aac aag aat aca acc acg act aga agc agg agt ata atc atg att caa cac cag cat NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA cca ccc ccg cct cga cgc cgg cgt cta ctc ctg ctt gaa gac gag gat gca gcc gcg gct NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA gga ggc ggg ggt gta gtc gtg gtt taa tac tag...

...em or their group on the server. Below is a copy of my smb.conf: ------------------------- /etc/smb.conf ------------------------------------ # Samba config file created using SWAT # from localhost.localdomain (127.0.0.1) # Date: 2001/03/04 17:35:08 # Global parameters [global] workgroup = CAA netbios name = SERVER server string = Samba 2.0.7-18mdk interfaces = eth0 encrypt passwords = Yes debug level = 2 os level = 65 preferred master = Yes wins support = Yes [test] comment = For Testing only by G & F path = /home/samba/test writeable = Y...

...blog article about it. >>> >>> https://blog.microlinux.fr/squid-https-centos/ >> >> I wonder if this works with all https enabled sites? Chrome has >> capabilities hardcoded to check google certificates. Certificate >> Transparency, HTTP Public Key Pinning, CAA DNS are also supporting >> the end node to identify MITM. I hope that such setup will be unpractical >> in the near future. >> >> About your legal requirements; Weighing is what courts daily do. So, >> such requirements are not asking you to destroy the integrity and &...

...og article about it. >>> >>> https://blog.microlinux.fr/squid-https-centos/ >> >> I wonder if this works with all https enabled sites? Chrome has >> capabilities hardcoded to check google certificates. Certificate >> Transparency, HTTP Public Key Pinning, CAA DNS are also supporting >> the end node to identify MITM. I hope that such setup will be unpractical >> in the near future. >> >> About your legal requirements; Weighing is what courts daily do. So, >> such requirements are not asking you to destroy the integrity and...

...> ------------------------------ > > Message: 3 > Date: Mon, 12 Oct 2020 08:33:44 +0200 (CEST) > From: =?UTF-8?Q?Frauke_G=C3=BCnther?= <guenther at leibniz-bips.de> > To: "r-help at r-project.org" <r-help at r-project.org> > Cc: William Michels <wjm1 at caa.columbia.edu>, "smm at posteo.org" > <smm at posteo.org> > Subject: Re: [R] Fwd: Help using the exclude option in the neuralnet > package > Message-ID: <957726669.124476.1602484424752 at srvmail.bips.eu> > Content-Type: text/plain; charset=&...

Hi there, In my last request I have asked info about backuppc and other backup solutions. After some test I have choosen bacula. Many people said it's too complex and try to make it works is a challenge. I've tested backuppc and I don't like it for a stupid reason... I must install on centos external software, configure a web server with cgi with suid enabled (apache does not have