search for: biostrings

Hello, Suppose in the following code, PROTECT(sr = R_tryEval( .... )) sr is a RAWSXP vector. I wish to return another RAWSXP starting at position 13 onwards (base=0). I could create another RAWSXP of the correct length and then memcpy the required bytes and length to this new one. However is there a more efficient method? Regards Saptarshi Guha

Dear List, I tested the example in the reposTools vignette: library(reposTools); Loading required package: tools genRepos("Test Repository", "http://biowww.dfci.harvard.edu/~jgentry/","newRepos"); Error in rep.int(colnames(x), nr) : unimplemented type 'NULL' in 'rep' Could someone help me out with this one? I'd appreciate all help.... I am

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

Hi, I want to group a large list (20 million) of strings into categories based on string similarity? The specific problem is: given a list of DNA sequence as below ACTCCCGCCGTTCGCGCGCAGCATGATCCTG ACTCCCGCCGTTCGCGCGCNNNNNNNNNNNN CAGGATCATGCTGCGCGCGAACGGCGGGAGT CAGGATCATGCTGCGCGCGAANNNNNNNNNN CAGGATCATGCTGCGCGCGNNNNNNNNNNNN ...... ..... NNNNNNNCCGTTCGCGCGCAGCATGATCCTG

Dear all, Does R has any function/package that can pack and unpack string into bit size? The reason I want to do this in R is that R has much more native statistical function than Perl. Yet the data I need to process is so large that it required me to compress it into smaller unit -> process it -> finally recover them back again into string with new information. In Perl the

Hi, I have a string "GGGGGGCCCAATCGCAATTCCAATT" What I want to do is to count the percentage of each letter in the string, what string functions can I use to count the number of each letter appearing in the string? For example, the letter "A" appeared 6 times, letter "T" appeared 5 times, how can I use a string function to get the these number? thanks, karena

Hi, The Biostrings package (Bioconductor) contains a function (g.test(), not exported) that does a G-test. It was originally written by Peter Hurd. See: https://stat.ethz.ch/pipermail/r-sig-ecology/2008-July/000275.html Peter Hurd's implementation of g.test() looks very much like the implementation of stats:...

...he only problem is that "mkChar" will make every foo string into a global CHARSXP cache. When I have a huge amount of file to read, the CHARSXP cache use too much memory. I do not know whether there is any other way to SET_STRING_ELT without the mkChar operation. I know I cam refer to the Biostrings pakcage's way of readDNAStringSet, but that is a bit complicated I have not full understood it. Any help will be appreciated!! Ge

...ndices ... * DONE (RColorBrewer) * Installing *source* package 'Biobase' ... ** libs /usr/lib/R/bin/SHLIB: line 115: make: command not found ERROR: compilation failed for package 'Biobase' ** Removing '/usr/local/lib/R/site-library/Biobase' * Installing *source* package 'Biostrings' ... ** libs /usr/lib/R/bin/SHLIB: line 115: make: command not found ERROR: compilation failed for package 'Biostrings' ** Removing '/usr/local/lib/R/site-library/Biostrings' ...... ...... Could you give me some advice about how to fix the errors? Thanks. Weigong Ge...

My goal is simple: calcuate GC content of each sequence in a list of nucleotide sequences. I have figured out how to vectorize, but all my attempts at memoization failed. Can you show me how to properly memoize my function? There is a StackOverflow post on the subject of memoization, but it does not help me: http://stackoverflow.com/questions/7262485/options-for-caching-memoization-hashing-in-r

...s is revealing a number of problems/misconceptions. (A) We do not check versions when loading namespaces, ahd the namespace registry does not contain version information. So that for example (rtracklayer) Depends: R (>= 2.7.0), Biobase, methods, RCurl Imports: XML (>= 1.98-0), IRanges, Biostrings will never check the version of namespace XML that is loaded, either already loaded or resulting from loading this package's namespace. For this to be operational we would need to extend the syntax of the imports() and importsFrom() directive in a NAMESPACE file to allow version restricti...

...os? > biocLite() Using R version 2.11.1, biocinstall version 2.6.7. Installing Bioconductor version 2.6 packages: [1] "affy" "affydata" "affyPLM" "affyQCReport" [5] "annaffy" "annotate" "Biobase" "biomaRt" [9] "Biostrings" "DynDoc" "gcrma" "genefilter" [13] "geneplotter" "GenomicRanges" "hgu95av2.db" "limma" [17] "marray" "multtest" "vsn" "xtable" Please wait... Warning in install.packages(pkgs = pkgs,...

...d my command syntax and got the following message: > library(help=biomaRt) Warning messages: 1: package 'JavaGD' was built under R version 2.9.0 and help may not work correctly 2: package 'Biobase' was built under R version 2.9.0 and help may not work correctly 3: package 'Biostrings' was built under R version 2.9.0 and help may not work correctly 4: package 'IRanges' was built under R version 2.9.0 and help may not work correctly 5: package 'CORNA' was built under R version 2.9.0 and help may not work correctly 6: package 'GEOquery' was built und...

Dear R users, I would like to align two protein sequences using BLAST (bl2seq). The question is whether this programm have been implemented in R. Thank you for your help, Alla.

...For more context, the actual code adds arguments to initialize and expects them to be provided by calls to 'new'; 'new' is not exposed directly to the user but via a constructor that always provides appropriate arguments. A specific example occurs when trying to install the package Biostrings v 2.11.44 from the Bioconductor devel repository. Martin -- Martin Morgan Computational Biology / Fred Hutchinson Cancer Research Center 1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109 Location: Arnold Building M2 B169 Phone: (206) 667-2793

This is about the new note Depends: includes the non-default packages: ‘BiocGenerics’ ‘Biobase’ ‘lattice’ ‘reshape’ ‘GenomicRanges’ ‘Biostrings’ ‘bumphunter’ Adding so many packages to the search path is excessive and importing selectively is preferable. Let us say my package A either uses a class B (by producing an object that has B embedded as a slot) from another package or provides a specific method for a generic defined in another pa...

Good day, If the library path is changed with .libPaths, the command install.packages("/nb/dario/Biostrings_2.39.9.tar.gz", repos=NULL) fails with ** testing if installed package can be loaded Error : package ?S4Vectors? required by ?Biostrings? could not be found However, running library(S4Vectors) followed by sessionInfo() after the error shows that the package can indeed be found by R R vers...

Hiya, I am trying to look at the similarities between a number of sequences, for example i am trying to see how similar "ababbbassdaa" is to "addffggssbbsbbs" I was wondering is the some way for me to see how similar they are in terms of, for example, number of a's, number of b's, how often a and ab are consecutive, how often abab is together etc. Any advice

Dear all, please could you suggest any R functions or packages (or external programs), that a. take as input a large number (> 10 000) of short 20-30 nt sequences, and do sequence assembly, to reconstruct larger (extended) 30-50 sequences ? b. take as input a larger number of sequences (100 000 - 1 mil) and cluster these sequences in distinct classes based on the sequence similarity ?

Hello I have 2 columns of short sequences that I would like to compare and count the number of mismatches and record the number of mismatches in a new column. The sequences are part of a data frame that looks like this: seq1=c("CGGTGTAGAGGAAAAAAAGGAAACAGGAGTTC","CGGTGGTCAGTCTGGGACCTGGGCAGCAGGCT", "CGGGCCTCTCGGCCTGCAGCCCCCAACAGCCA")