Displaying 20 results from an estimated 32 matches for "bia".
Did you mean:
bi
2009 Jul 15
3
Axes origins and labeling
...;)
par(family="serif", cex=1.2, lab=c(length(gut),4,4))
boxplot(Xc~Trt,data=error,ylab="Reactance (Ohms)",xlab="Stomach Fullness",
ylab="Reactance (Ohms)", axes=FALSE,ylim=c(50,200))
axis(side=1, at=c(1,2,3,4), labels=gut)
axis(side=2)
text(1.5,115, "Mid BIA")
text(3.5,160, "Whole BIA")
points(1,135, pch=2)
points(2,135, pch=2)
points(3,135, pch=17)
points(4,135, pch=17)
Thanks ahead of time.
Keith
--
Keith Cox, Ph.D.
Alaska NOAA Fisheries, National Marine Fisheries Service
P.O. Box 464
Sitka, Alaska, 99835
907 752-0563
marlinkcox@g...
2006 May 09
8
Dynamically printing a page
...;html>
<head>
<script language="javascript" type="text/javascript">
window.focus();
window.print();
</script>
</head>
<body>
...
</body>
</html>
Thanks for any help
Jim
--
Jim Geurts
Bia Creations, LLC
http://biacreations.com
410-493-9385
_______________________________________________
Rails-spinoffs mailing list
Rails-spinoffs-1W37MKcQCpIf0INCOvqR/iCwEArCW2h5@public.gmane.org
http://lists.rubyonrails.org/mailman/listinfo/rails-spinoffs
2010 Jan 26
4
reading a string vector
Hi, I need to read a string vector in R which is like this
"atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as
a unique vector input when I read in like x <-
"atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I
can use each of the letters on my reading?
Thanks,
Beatriz
--
View this message in context:
2005 Mar 08
4
Non-linear minimization
...ian=TRUE,print.level=2)
with estdata() a function which returns value to fit
with dN (observed data vactor)
My problem is that only optim() allows me to set
parameters interval with "L-BFGS-B" method but this
one doesn't work in my case.
I have heard about nls2 package (www.inra.fr/bia) but
it doesn't work on Windows.
Do you know any solutions
Thank's a lot for reading my post
Best regards
Sebastien
INA P-G ecology dpt
2002 Feb 20
3
importing images
...Thanks in advance
--
Herve CARDOT
____________________________________________________________
Unite Biometrie et Intelligence Artificielle, INRA Toulouse
BP 27, 31326 Castanet-Tolosan cedex, France.
Tel: (+33)5.61.28.50.64 mailto:Herve.Cardot at toulouse.inra.fr
Page Equipe: http://www.inra.fr/bia/T/modelisation/Doc/
Page Perso: http://www.inra.fr/bia/T/cardot/
-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-.-
r-help mailing list -- Read http://www.ci.tuwien.ac.at/~hornik/R/R-FAQ.html
Send "info", "help", or "[un]subscribe"
(in...
2005 Oct 21
3
Windows interacting with SAMBA share
Hi,
My company has a Samba [3.0] share on a Debian Linux 3.0 [Kernel 2.6]
machine and we are trying to copy a large file [>2GB] from a Windows
machine to the Samba share. When we try to do this, it only copies 2GB
of the information. We were previously having a similar issue when
transfering a large file [>2GB] from Linux to a Windows shar...
2016 Jun 20
3
samba 4 AD and master browser
...om>:
> First of all, thanks for you answer.
>
> "Problem" is that our users are using this feature, and if we can keep
> this should be the best option to ensure that our user have detecte any
> difference with samba 3 and samba 4...
>
> Other options, it could be bia gpo add a shortcut to computer in desktop,
> to emulate/simulate same feature, user normally only use one machine,
> fileserver... It is possible?
>
> Thanks
>
>
>
> 2016-06-20 18:14 GMT+02:00 Trenta sis <trenta.sis at gmail.com>:
>
>> Hi,
>>
>> I&...
2009 Apr 05
4
Game install failed
Hello, tried to install Brothers In Arms: Earned In Blood in Hardy, Wine 1.1.18, and it gets through the entire install, then asks me to reboot. When i click yes, the window disappears. But nothing happens. I open it again to find the same prompt right in front of my face. I've tried wineboot in the Terminal, tried even restarting ubuntu itself. But it always comes up with that same
2011 Dec 09
2
display memory usage
Does anybody knows how can I display the memory usage in R? I'd like to know
how much RAM R is using to store a data set that I'm reading, is it
possible?
Thanks in advance,
Beatriz
--
View this message in context: http://r.789695.n4.nabble.com/display-memory-usage-tp4175898p4175898.html
Sent from the R help mailing list archive at Nabble.com.
2017 Feb 10
2
/usr/sbin/samba_dnsupdate: ERROR: Record already exist
On Fri, 10 Feb 2017 14:29:00 +0100
Patrik <alabard at gmail.com> wrote:
> *Same result:*
> Calling samba-tool dns for SRV _ldap._tcp.Default-First-Site-Name._
> sites.ForestDnsZones.ac.patrikx3.tk server.ac.patrikx3.tk 389 (add)
> Calling samba-tool dns add -k no -P ['192.168.78.20',
> 'ac.patrikx3.tk',
>
2011 Aug 25
2
following a packet from sendto() to wire (and reverse)
...hat it
was lost (or misdirected) somewhere in the IP stack.
We did use Dtrace with syscall::sendto:entry/exit to prove that the
application did send the packet, but so far we have no clue how to
determine what happens to the packet afterwards.
Is there a Dtrace script that follows a packet queued bia send(2) or
sendto(2) through the kernel/stack and can indicate
whether some low-level function returns a failure, or
possibly hands it to a different interface (we snooped all except the
unsnoopable lo though w/o luck)..
I looked at the Dtrace Networking Guide but without more knowledge
of interna...
2016 Jun 21
1
samba 4 AD and master browser
...; >>
> >> "Problem" is that our users are using this feature, and if we can keep
> >> this should be the best option to ensure that our user have detecte any
> >> difference with samba 3 and samba 4...
> >>
> >> Other options, it could be bia gpo add a shortcut to computer in
> desktop,
> >> to emulate/simulate same feature, user normally only use one machine,
> >> fileserver... It is possible?
> >>
> >> Thanks
> >>
> >>
> >>
> >> 2016-06-20 18:14 GMT+02:00 Trent...
2000 Apr 15
2
unresolved symbols in dynamically linked code
I'm probably misunderstanding something in "Writing R Extensions" version
1.0.0. In the chapter on the R API, section 4.7, it is stated that the
functions listed in R_ext/Linpack.h are available to users' Fortran code.
I am developing a developing a library of ode solvers, based on lsoda and
ddassl, and which in turn call some routines from linpack and double
precision blas. I
2016 Jun 20
4
samba 4 AD and master browser
Hi,
I'm migrating samba 3 nt domain (openldap + samba) to samba 4 AD, and we
detected taht one of features, master browser is not working in samba 4 AD.
I have searched some info and I have found:
https://wiki.samba.org/index.php/FAQ
"
Why is Network Neighbourhood empty or does not show all machines in an
Samba AD environment?
The master browser code in smbd does not collect names
2016 Jun 20
0
samba 4 AD and master browser
First of all, thanks for you answer.
"Problem" is that our users are using this feature, and if we can keep this
should be the best option to ensure that our user have detecte any
difference with samba 3 and samba 4...
Other options, it could be bia gpo add a shortcut to computer in desktop,
to emulate/simulate same feature, user normally only use one machine,
fileserver... It is possible?
Thanks
2016-06-20 18:14 GMT+02:00 Trenta sis <trenta.sis at gmail.com>:
> Hi,
>
> I'm migrating samba 3 nt domain (openldap + samba)...
2016 Jun 21
0
samba 4 AD and master browser
...ll, thanks for you answer.
>>
>> "Problem" is that our users are using this feature, and if we can keep
>> this should be the best option to ensure that our user have detecte any
>> difference with samba 3 and samba 4...
>>
>> Other options, it could be bia gpo add a shortcut to computer in desktop,
>> to emulate/simulate same feature, user normally only use one machine,
>> fileserver... It is possible?
>>
>> Thanks
>>
>>
>>
>> 2016-06-20 18:14 GMT+02:00 Trenta sis <trenta.sis at gmail.com>:
>&g...
2017 Feb 10
0
/usr/sbin/samba_dnsupdate: ERROR: Record already exist
Nope at all!! I dont understand why it does automatically!
I think BIND does it via DLZ already, I think it does twice.
But why?
How can I remove the samba_dnsupdate? I see it runs it again since Bind I
think it already does bia DLZ, not?
Nothing in crontab. Is it a Samba setting in smb.conf somehow misconfigured?
I set promision and no error except this fills my log.
:( :(
*Patrik*
*GTalk: *alabard at gmail.com
*Web:*
http://www.patrikx3.tk
*Mobile:*
+36 20 342 8046 <+36+20+342+8046>
On Fri, Feb 10, 2017 a...
2017 Feb 10
1
/usr/sbin/samba_dnsupdate: ERROR: Record already exist
...9 PM, Patrik <alabard at gmail.com> wrote:
> Nope at all!! I dont understand why it does automatically!
> I think BIND does it via DLZ already, I think it does twice.
> But why?
> How can I remove the samba_dnsupdate? I see it runs it again since Bind I
> think it already does bia DLZ, not?
> Nothing in crontab. Is it a Samba setting in smb.conf somehow
> misconfigured?
> I set promision and no error except this fills my log.
> :( :(
>
>
>
>
> *Patrik*
>
>
> *GTalk: *alabard at gmail.com
>
> *Web:*
> http://www.patrikx3.tk
>
&...
2004 Sep 25
1
ilbc problem
...fined
symbol: sqrt
Sep 25 15:15:43 WARNING[16384]: loader.c:429 load_modules: Loading
module codec_ilbc.so failed!
Is it possible to compile Asterisk wo. any codecs, or what's the easiest
way to solve this problem? (We are using AudioCodes hardware to
terminate VoIP into PSTN).
Distr. - Debian Woody 3.0, libc6 2.3.2, kernel 2.4.26
--
Marcin Kwiatkowski
http://www.telebonus.pl/
Telebonus Sp. z o.o.
43-300 Bielsko-Bia?a
ul. Legion?w 30
pho.: +48 (33) 819 49 66
mob.: +48 605 923 944
2011 Dec 05
3
iterative variable names
Hi,
I'm trying to assign iterative names to variable, but all my attempts have
failed. I have a loop, and for every iteration, I need to create a variable,
and I'd like to name them iteratively, such as:
for(i in 1:10)
{
x_i <- c(values)
}
I need it to return ten variables: x_1, x_2, ..., x_10
How can I do it?
Thank you very much!
Beatriz
--
View this message in context: