search for: baseonly

I?m trying to build a 2.6.18-128.1.6.el5 kernel without kabichk. I have downloaded the sources, installed the compiler, etc and ran the following command rpmbuild -bb --target=`uname -m` --without kabichk --with baseonly --without debug \ --without debuginfo kernel-2.6.spec. I had modified the .SPEC file according to the WIKI page http://wiki.centos.org/HowTos/Custom_Kernel I have NOT installed any patches that will break KABI, but I am wanting to patch the kernel for SCST, and that will do it. Currently, I?...

Any better solution than this ? sum(strsplit("TCGGGGGACAATCGGTAACCCGTCT", "")[[1]] == "G") _________________________________________________________________ [[alternative HTML version deleted]]

My goal is simple: calcuate GC content of each sequence in a list of nucleotide sequences. I have figured out how to vectorize, but all my attempts at memoization failed. Can you show me how to properly memoize my function? There is a StackOverflow post on the subject of memoization, but it does not help me: http://stackoverflow.com/questions/7262485/options-for-caching-memoization-hashing-in-r

...ance and logical subscripts To: r-help@r-project.org Message-ID: <23745814.post@talk.nabble.com> Content-Type: text/plain; charset=us-ascii Thank you! The script is now adapted to Biostrings and it is really fast! For example, it does:   alph_sequence <- alphabetFrequency(data$sequence, baseOnly=TRUE)   data$GCsequence <- rowSums(alph_sequence[,c("G", "C")]) / rowSums(alph_sequence) in the G+C computation. It also works amazingly fast in substring extraction (substring), reverse complement (reverseComplement sequences), palindromes search (findComplementedPalindrome...